1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mezya [45]
3 years ago
10

DNA is made up of pairs of nitrogenous bases. Which of the following

Biology
1 answer:
ELEN [110]3 years ago
7 0

Answer:

Hi, there the answer is B.

Explanation:

You might be interested in
What is the molecule in this image?
Ratling [72]

Answer:

Protein.

Explanation:

In the image above, we see a molecule that is made up of several amino acids. The molecule that is made up of amino acids is protein.

Proteins are the most abundant organic macromolecules in cells, fundamental to cell structure and function. They are found in all cell types and viruses.

They are formed by amino acids linked together and joined by peptide bonds, as shown in the image above.

Of extremely high molecular weight, proteins are composed of carbon, hydrogen, nitrogen and oxygen, practically all of them have sulfur. Elements such as iron, zinc and copper may also be present.

All proteins are made up of a set of 20 amino acids, arranged in varying specific sequences.

3 0
3 years ago
Which one of the codons below would stop the translation of mRNA by ribosomal subunits?
Ostrovityanka [42]

Answer:

The correct option is D) UAG, UAA, UGA

Explanation:

The amino acid sequencing code or mRNA code contains specific codes which start and stop the process of translation at the right time. If the stop codon were not present then the ribosomal machinery would have made faulty proteins. If the stop codons are not at the right place, then it results in the production of faulty proteins. The stop codons which terminate the process of translation are UAG, UAA and UGA.

5 0
2 years ago
Why does the rate of photosynthesis increase and then reach a plateau as the concentration of co2 around a plant increases?
IrinaVladis [17]
 Answer

Light intensity increases also, but it gets to a point that the temperature increases and denature the enzymes involved so a plateau results.

5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Why is grass and most leafs and stems green
bija089 [108]

Leaves and grass serve to collect energy from the sun, through photosynthesis. Chlorophyll in the leaf gives the grass its green color.

I really hope this answer helps you out! It makes my day helping people like you and giving back to the community that has helped me through school! If you could do me a favor, if this helped you and this is the very best answer and you understand that all of my answers are legit and top notch. Please mark as brainliest! Thanks and have a awesome day!

5 0
3 years ago
Read 2 more answers
Other questions:
  • Does a gene mutation or a chromosome mutation cause alkaptonuria? Explain
    11·1 answer
  • Which process requires cellular energy to move
    12·1 answer
  • Describe the biological needs for cells to be surrounded by a membrane that is selectively permeable for different materials.
    6·1 answer
  • Energy is released from atp when
    11·2 answers
  • Two states of matter present in the water cycle are described below.
    6·1 answer
  • Mathematician who proposed that the planets orbited the sun in elliptical orbits
    13·1 answer
  • Which would stop the planet from being able to grow
    13·1 answer
  • What kind cell has chromosomes like this
    6·1 answer
  • (WILL GIVE BRAINLY) HELP SOMEONE PLEASE!!
    11·1 answer
  • Why are there craters on the surface of the moon?(1 point)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!