1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nutka1998 [239]
3 years ago
13

I WILL MARK BRAINLIEST PLZ HELP !!

Biology
1 answer:
nikklg [1K]3 years ago
4 0

Answer:

ice sheets, water vapor. and rivers

Explanation:

You might be interested in
4. Which of the following is an example of kinetic energy?
allochka39001 [22]

Answer:

2nd or B

Explanation:

Kinetic energy is energy in motion. it couldn't be A, because the roller coater isn't moving. It couldn't be C, because that is called potential energy. It can't be D because the light is off.

Hope this helped, and please mark as Brainliest :)

5 0
3 years ago
EXPLAIN How might you use engineering, either by designing a device or process,
Mashutka [201]
Use the basic engineering flow chart

Find your problem
Identify solution
Basic calculations
Prototype
Review
Does it work? If not start again from prototype
8 0
3 years ago
*PLEASE READ CAREFULLY*
Scrat [10]

Answer: 4

Explanation: I take biology now in college my senior year and what I’ve learned is energy cannot be created nor destroyed what is form can be changed and you literally can Google that and it’ll tell you the exact same thing

8 0
3 years ago
What is Earth Place Science ?
lesya [120]

Answer:

Earth and space science explores the interconnections between the land, ocean, atmosphere, and life of our planet. These include the cycles of water, carbon, rock, and other materials that continuously shape, influence, and sustain Earth and its inhabitants

Explanation:

6 0
3 years ago
Which of these would best describe the outcome of increasing the kinetic energy of the molecules in the above picture
masya89 [10]

The question is incomplete, the complete question is:

Which of these would best describe the outcome of increasing the kinetic energy of the molecules in the above picture? A) The temperature will increase. B) The temperature will decrease. C) The temperature will remain unchanged. D) The temperature would fluctuate up and down.

Answer:

The temperature will increase

Explanation:

Temperature is defined as the average kinetic energy of the molecules of a body. Increasing the kinetic energy of the molecules will also increase the temperature of the molecules.

Similarly, kinetic energy is proportional to temperature. Hence an increase in the kinetic energy of molecules also leads to increase in the temperature of the system.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Grass, trees, and cacti all reproduce by
    6·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • HELP ASAP!!! WILL MARK BRAINLIEST!!!
    11·1 answer
  • The _______ is located in your upper arm. A. fibula B. tibia C. femur D. humerus
    12·2 answers
  • Alexis plays on her school basketball team Practice used to be right after school, but has recently been changed to 6 PM.
    13·2 answers
  • What do you wanna be when you grow up? How does it impact or improve the world
    13·2 answers
  • A severe fever of 106º F (41º C) will Two of the answers are correct. increase uncatalyzed reaction rates by increasing the kine
    10·1 answer
  • At which phase of the cell cycle do centrioles begin to move apart in animal cells?
    14·2 answers
  • Which statement is scientifically based?
    15·2 answers
  • She counts 8 worms and 15 pill bugs She sees a little bit of grass the worm makes up a
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!