Answer:
10
Explanation:
pH is defined as the negative logarithm of the concentration of hydrogen ions.
Thus,
pH = - log [H⁺]
Thus, from the formula, more the concentration of the hydrogen ions or more the acidic the solution is, the less is the pH value of the solution.
Thus, solution with pH = 3 will be more acidic than solution with pH =4
Thus, concentration of the [H⁺] when pH =3
3 = - log [H⁺]
[H⁺] = 10⁻³ M
For pH = 4, [H⁺] = 10⁻⁴ M
<u>hence, pH = 3 is 10 times more acidic than pH = 4</u>
-20.16 KJ of heat are released by the reaction of 25.0 g of Na2O2.
Explanation:
Given:
mass of Na2O2 = 25 grams
atomic mass of Na2O2 = 78 gram/mole
number of mole = 
= 
=0. 32 moles
The balanced equation for the reaction:
2 Na2O2(s) + 2 H2O(l) → 4 NaOH(aq) + O2(g) ∆Hο = −126 kJ
It can be seen that 126 KJ of energy is released when 2 moles of Na2O2 undergoes reaction.
similarly 0.3 moles of Na2O2 on reaction would give:
= 
x = 
= -20.16 KJ
Thus, - 20.16 KJ of energy will be released.
Answer:
Hereditary information in the cell would be destroyed.
Explanation:
The nucleus can be defined as a membrane bound organelle that is found in eukaryotic cells. The main function of the nucleus is that it controls all activities that is related to the growth of the cell and also reproduction. The nucleus contains the cell hereditary information(DNA).
The nucleus is the most important organelle in the cell, It can sometimes be referred to as the brain of the cell. Therefore any health related condition that affects the nucleus would directly destroy all hereditary information that is stored in the cell.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
A balanced equation is a prime example of the law of the conservation of mass as the number of atoms in the reactants is consistent with the number of atoms in the reactants meaning the amount of matter has not changed and no mass has been created or destroyed hence obeying the law.
