All categories

2 years ago

Which atmospheric layer is represented by F? What are its characteristics?

Chemistry

1 answer:

Virty [35]2 years ago

4 0

Answer:

Ionosphere.

Explanation:

The atmospheric layer that is represented by F is known as IONOSPHERE.

The characteristics of Ionosphere

1. It is considered to be located in the upper layer of the earth's atmosphere due to the location of region F.

2. It is ionized by solar radiation that contains an electrical charge.

3. It functions as a reflector. This can be observed in radio waves broadcasting.

You might be interested in

What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

2 years ago

Consider the balanced equation. 2HCl + Mg MgCl2 + H2 If 40.0 g of HCl react with an excess of magnesium metal, what is the theor

Serga [27]

Answer:

Theoretical yield of hydrogen is 1.11 g

Explanation:

Balanced equation, $Mg+2HCl\rightarrow MgCl_{2}+H_{2}$

As Mg remain present in excess therefore HCl is the limiting reagent.

According to balanced equation, 2 moles of HCl produce 1 mol of $H_{2}$ .

Molar mass of HCl = 36.46 g/mol

So, 40.0 g of HCl = $\frac{40.0}{36.46}moles$ of HCl = 1.10 moles of HCl

Hence, theoretically, number of moles of $H_{2}$ are produced from 1.10 moles of HCl = $(\frac{1}{2}\times 1.10)moles=0.550moles$

Molar mass of $H_{2}$ = 2.016 g/mol

So, theoretical yield of $H_{2}$ = $(0.550\times 2.016)g=1.11g$

7 0

3 years ago

Read 2 more answers

What is a logical way that you could begin to investigate why your tire had low air pressure? Look to see if there is a hole in

MrRissso [65]

Answer:

Any of the answers given will work

Explanation:

I literally just did it.

7 0

2 years ago

Read 2 more answers

According to the law of conservation of mass, if an element A has an atomic mass of 2 mass units and element B has an atomic mas

LenaWriter [7]

The law of conservation of mass states that mass is neither created nor destroyed. Since we have 2 g/mol of A and 3 g/mol of B then AB should be equal to the sum of their molar mass that is

2 g/mol + 3 g/mol = 5 g/mol AB

for the case of A2B3

A2 = 2 * 2 = 4 g/mol
B3 = 3 * 3 = 9 g/mol

therefore A2B3 = 13 g/mol

5 0

3 years ago

In a combustion reaction, one of the reactants is _____.

zepelin [54]

The answer is oxygen

3 0

2 years ago

Read 2 more answers