1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zaharov [31]
3 years ago
7

The formula CaCl, represents the compound

Biology
2 answers:
elena55 [62]3 years ago
8 0

Answer:

It represents the compound calcium chloride

Explanation:

eimsori [14]3 years ago
8 0
Calcium chloride is the correct answer ....
You might be interested in
What is an ecological niche?​
Yuri [45]

Answer:

"Ecological niche is a term for the position of a species within an ecosystem, describing both the range of conditions necessary for persistence of the species, and its ecological role in the ecosystem."

Explanation:

sources: sciencedirect

7 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Drinking non-potable water does not carry significant health risks
lesya [120]
Non potable waters are not for drinking. It is not safe to be drink that's why drinking it can carry significant health risk on our body. Non potable waters are only for irrigation and other non drinking water activity. POtable waters are the water that is clean and safe to drink

5 0
3 years ago
Read 2 more answers
Which of the following is a human-made factor that can change climate?
fredd [130]

Answer:

The answer is

A. Agriculture

3 0
3 years ago
Most of the fish in a lake produce a certain number of eggs each spring. However, one fish has the ability to carry and lay more
tamaranim1 [39]
Genetic. And it allows for more fish to be created and living freely 
6 0
4 years ago
Read 2 more answers
Other questions:
  • The diagram below shows a material being cycled between the living and nonliving environments.
    14·1 answer
  • What are bananas made of
    13·1 answer
  • Which factor helps determine the fertility rate of a group of people
    5·1 answer
  • Which sentence would be inappropriate in an informational piece of writing with a formal tone?
    15·2 answers
  • What is a prokaryote, and when did prokaryotes arise?
    11·1 answer
  • Organic molecules usually contain
    8·1 answer
  • Is pyruvate oxidized or reduced during glycolysis?
    10·1 answer
  • What characteristic do all endocrine glands share?
    12·1 answer
  • Cardinals reproduce sexually. Many types of fungi can reproduce asexually by producing spores. A fungus does not need to _______
    12·2 answers
  • 5. Which of the following result in protein?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!