1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
2 years ago
8

1. Fish What is the meaning of fish ​

Biology
1 answer:
iogann1982 [59]2 years ago
4 0

Answer:

a limbless cold-blooded vertebrate animal with gills and fins and living wholly in water.

Explanation:

G00gle

You might be interested in
A psychological response to an out-of-the-ordinary stressor defines:
DIA [1.3K]
<span>A psychological response to an out-of-the-ordinary stressor defines the posttraumatic stress disorder (PTSD).
When people are exposed to a traumatic event, such as war, or sexual assault, or generally any type of threat or tragedy, they may develop PTSD as a result. This means that the person will still have strong and negative emotions, such as fear, or hatred, months or years after the event occurred, and it is very difficult to treat.
</span>
7 0
3 years ago
What organism would break down the dead animals and put nutrients into the soil? What organisms would benefit from them?
posledela
Decomposers break down dead animals and plants. They usually benefit producers by releasing nutrients back in the soil.
7 0
3 years ago
Which of the bonding types below would be used between a positive sodium ion and negative bromide ion?
Feliz [49]

Answer:

Ionic bonding When metals react with non-metals, electrons are transferred from the metal atoms to the non-metal atoms, forming ions . The resulting compound is called an ionic compound .

Explanation:

7 0
3 years ago
Read 2 more answers
Despite considerable concern about the high rate of _________ use among pregnant women, studies have failed to find a homogeneou
Arturiano [62]
<span>Despite considerable concern about the high rate of Cocaine use among pregnant women, studies have failed to find a homogeneous pattern of fetal effects, and there is little consensus on the adverse effects of the drug.
</span>

Cocaine<span> is a street drug that usually comes as a white powder. </span>Cocaine use during pregnancy can affect a pregnant<span> woman and her unborn baby in many ways.</span>

4 0
3 years ago
If a bowler rolls a bowling ball at a constant speed, would the force increase if he or she changes the weight of the ball? Expl
CaHeK987 [17]

Answer:

This is what we call Potential Energy and Kinetic Energy

Explanation:

If the bowler is rolling a ball, let's say 5 LBS, It should travel at normal speed.

The speed is also dependent on how the bowler throws the ball.

If they were to change the weight of the ball. It would most likely slow the ball down more, as it would be too heavy to go as fast if it was a lightweight ball.

It's like a person. The bigger and heavier they are, the slower they will move with their own consecutive speed. If they are lighter, they'll most likely go faster

7 0
3 years ago
Other questions:
  • Who discovered DNA structure?
    10·2 answers
  • Explain the difference between weathering and erosion
    6·1 answer
  • Hypertonic defintion
    9·1 answer
  • Which of the following might have influence whether or not a comet will collide with a nearby planet
    10·1 answer
  • Prior do the 1600s it was believed that all living things for either plants or animals. Which of these inventions led to the dev
    6·1 answer
  • Carbon atoms have four electrons in their outer shell. This means that a single carbon atom can form up to _______ bonds with ot
    12·1 answer
  • PLEASE HELP IM SO CONFUSED!!!
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Complete the following analogy. Plant is to dermal tissue as animal is to ______ tissue. a. connective b. epithelial c. muscle​
    6·1 answer
  • Factorise completely pq - q?​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!