1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kicyunya [14]
3 years ago
12

Cells identical to original cell is it mitosis or meiosis

Biology
1 answer:
dimulka [17.4K]3 years ago
6 0

Mitosis

Explanation ~ Mitosis creates two daughter cells each having the same number and kind of chromosomes as the parent nucleus

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Question 1 (1 point)
My name is Ann [436]

Answer:

X: Positive gravitropism

Y: Negative gravitropism

Explanation:

i just did the quiz and got it correct

7 0
4 years ago
Read 2 more answers
Elements, which are unstable elements that release energy as
madreJ [45]

\huge\bold\red{₳₦₴₩ɆⱤ:-}

Absolute Dating

AKA. RADIOMETRIC DATING

We can learn about the past by studying the present.

The Principle of Uniformitarianism states that current geological processes are the same processes that were at work in the past. This principle was proposed by Charles Lyell in the 1800's

Absolute Dating

Involves finding the absolute age (actual age) of a rock or fossil.

Elements that emit particles and energy are radioactive.

As radioactive elements emit particles and energy, they form new isotopes or elements.

6 0
3 years ago
Read 2 more answers
Which of the following is an advantage that a farmer would see when using a genetically engineered ?
IRISSAK [1]
The only answer that could be considered an advantage is C. Increasing the amount of crops harvested.
4 0
3 years ago
Read 2 more answers
n what form will Susan be able to capture that phosphorous as it is released from the sedimentary rock?
blsea [12.9K]

The correct answer is Soluble phosphorous

Soluble phosphorus is a measure of orthophosphate (PO4), the soluble and inorganic filterable fraction of phosphorus, which is the most stable type of phosphate and it is the form directly used up by the plant cells.

7 0
3 years ago
Other questions:
  • Ally thinks she is pregnant because she has not had her period in two months. the hormone responsible for her lack of menstruati
    9·1 answer
  • What is the name of the enzyme that breaks down: a. Protein? b. Carbohydrate? c. Fat/oil?
    10·1 answer
  • State one reason why the ozone shield is important
    11·1 answer
  • Which phase of cell division is shown in this visual?
    15·1 answer
  • How do composite volcanoes get its layered interior?
    10·2 answers
  • When treating chlamydia,
    12·1 answer
  • Which of the following best explains what would happen if there were no decomposers in an ecosystem?
    6·1 answer
  • Which of these types of weathering does not require the presence of water?
    9·1 answer
  • The primary electron acceptor in photosystem II is __________. Group of answer choices P700 P700 P680 P680
    7·1 answer
  • To remember abdominal muscles, explain what TIRE stand for the phrase “spare TIRE”.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!