1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
3 years ago
10

What is a biome. in your own words

Biology
2 answers:
kenny6666 [7]3 years ago
4 0

Answer:

Its basically like a climate zone it has a specific terrain and weather

Explanation:

kompoz [17]3 years ago
4 0
It is an Area with a unique climates and unique terrain
You might be interested in
What does the graph show the importance of clean air?
natulia [17]

Answer:

C. Most people will die from negative health effects associated with stroke as indoor dirty air builds up.

Explanation:

<u>C is correct option</u> because it shows the highest proportion of people's death caused by stroke. On the other options are not correct due to the following reasons:

A is incorrect because it says that people have a lower risk of dying from COPD. On the other hand, the graph shows that this is 3rd most abundant cause of deaths.

B is incorrect because deaths due to lung cancer are the lowest according to the graphical illustration.

D is incorrect because the proportion of developing acute lower respiratory infection and ischemic heart disease are not the same. Deaths due to ischemic heart disease are higher than the acute lower respiratory infection.

4 0
3 years ago
Read 2 more answers
If Gloria gets violently ill a couple of hours after eating contaminated food, she will probably develop an aversion to the tast
Lena [83]

Answer:

Biological predispositions

Explanation:

A Biological Predisposition is an expanded possibility of building up an infection or example of conduct dependent on the qualities we acquired from our folks (and our's folks). Qualities impact our character attributes, our IQ, our probability of getting malignant growth, and even our odds of turning into a heavy drinker.

Being predisposed to a turmoil doesn't imply that we will create it, just that we are progressively powerless against it dependent on our hereditary cosmetics. Natural hazard variables join with ecological factors, for example, stress or diet to trigger a confusion.

Research studies utilizing twins have demonstrated that numerous attributes and disarranges are heritable. For instance, in indistinguishable twin sets, on the off chance that one twin is determined to have schizophrenia, there is a half shot that the other twin will likewise be analyzed. Be that as it may, in congenial twin matches, this rate is just 15%. Since indistinguishable twins share a larger number of qualities than brotherly twins, we can infer that schizophrenia has an acquired organic premise.

8 0
3 years ago
Heterotrophic organisms used the process of fermentation to nourish. What is fermentation?
Mama L [17]
Fermentation is a type of chemical process which enables heterotrophs to obtain energy without oxygen . Heterotrophs uses procedure of fermentatation to cultivate because in process of fermentation enzymes are the catalysts and they provide energy to heterotrophs
8 0
3 years ago
How is a nuclear envelope similar to a cell membrane
Bond [772]

Answer:

It is similar because the nuclear envelope is a membrane similar to the cell membrane around the whole cell. There are pores and spaces for RNA and proteins to pass through while the nuclear envelope keeps all of the chromatin and nucleolus inside. When the cell is in a resting state there is something called chromatin in the nucleus.

Explanation:

6 0
3 years ago
Read 2 more answers
Why are fossil fuels considered a nonrenewable resource
dexar [7]
Because their use is not sustainable because their formation takes billions of years to renew them
8 0
3 years ago
Read 2 more answers
Other questions:
  • What five criteria must be met for a substance to be a mineral.
    12·1 answer
  • A normal fault is formed from compressional stress. select one:<br> a. true<br> b. false
    5·1 answer
  • A team of researchers calculates that a glacier will melt completely away in the next 100 years. Which land structure will most
    7·1 answer
  • Which of the following correctly compares how plant and animal cells differ?
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Why Might People Be Against Cloning? (2+ complete sentences)
    13·1 answer
  • Can you help me please i will give you a branlist and it’s science
    12·1 answer
  • 1. If you were a predator bird, which moth would be
    14·2 answers
  • The energy in most food comes from synthesis true or false
    6·2 answers
  • Neurons and neuroglia work together to form nervous tissue, which is part of the nervous system. Which describes neurons and neu
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!