Answer:
NaOH(aq) + HNO3(aq)------>NaNO3(aq) + H2O(l)
Explanation:
A thing to note is that an acid and a base will react to form a metal salt + H2O.
~Hope it helps:).
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
First a balanced reaction equation must be established:
→
Now if mass of aluminum = 145 g
the moles of aluminum = (MASS) ÷ (MOLAR MASS) = 145 g ÷ 30 g/mol
= 4.83 mols
Now the mole ratio of Al : O₂ based on the equation is 4 : 3
[
4Al +
3 O₂ → 2 Al₂O₃]
∴ if moles of Al = 4.83 moles
then moles of O₂ = (4.83 mol ÷ 4) × 3
=
3.63 mol (to 2 sig. fig.)
Thus it can be concluded that
3.63 moles of oxygen is needed to react completely with 145 g of aluminum.
An aqueous solution of hydrozen chloride: Strongly corrosive acids
A colouriess punpent liquid widely used in manufacturing plastic and pharmaceutical
Answer:
B
Explanation:
The tendency of a liquid to convert to vapour increases smoothly with increasing temperature. Vapour pressure shows the tendency of a liquid to convert to vapour. Increase In vapour pressure shows an increased tendency to convert to vapour. The higher the temperature, the higher the vapour pressure.
