1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
matrenka [14]
3 years ago
7

A car is 8.4 lb. what is the mass of the cat in kilograms?

Chemistry
1 answer:
o-na [289]3 years ago
4 0
Do you have round to anything? If you don't have to round the answer is 3.81018 kg. :)

You might be interested in
Which of the following is an example of a contact force?
Virty [35]
C. A person pushing a box across the floor
7 0
3 years ago
Read 2 more answers
Calculate the quotient [co32–]/[hco3–] at ph 10.75.
KATRIN_1 [288]

The chemical equation is:

<span>HCO3^    ->  H^+ + CO3^2- </span>

 

We know that the formula for Ka is:
Ka = [H^+][CO3^2-]/[HCO3^-] 


log Ka = log[H^+] + log[CO3^2-]/[HCO3^-] 
pKa = pH - log[CO3^2-]/[HCO3^-] 
log[CO3^2-]/[HCO3^-] = pH - pKa = 10.75 - 10.329 = 0.421 
<span>[CO3^2-]/[HCO3^-] = Antilog (0.421)  = 2.636 </span>

 

Answer:

<span>2.636</span>

3 0
3 years ago
An ionic bond can be formed when one or more electrons are 1) equally shared by two atoms 2) unequally shared by two atoms 3) tr
Lyrx [107]

Answer:

4) transferred from the valence shell of one atom to the valence shell of another atom

Explanation:

Electrons are located outside of the nucleus which contains the protons and the neutrons.

For bonds to form, valence electrons located in the outermost shell electrons are involved. These are the valence electrons. These outer shell electrons can be shared or transferred between two combining atoms to form stable atoms.

In ionic bonds, the electrons are transferred from one specie to another. The atom that loses the electrons becomes positively charged and the receiving atom becomes negatively charged. This is the crux of ionic bonds.

6 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Help answer this no copying from Google
erastovalidia [21]

Answer:

The particle theory of light was given by Isaac Netwon state that light was made of particles that allow light to undergo reflection and refraction.

The wave theory of light ​was contemporary of the particle theory of light given by Christiaan Huygens. It states that light was a wave that allows light to undergo reflection and refraction when passes through different mediums.

3 0
4 years ago
Other questions:
  • Which of the following reactions could be used to power a battery because of the transfer of electrons?
    8·1 answer
  • What is the energy absorbed in this endothermic nuclear reaction 14 7 N + 4 2 H e → 17 8 O + 1 1 H 7 14 N + 2 4 H e → 8 17 O + 1
    8·1 answer
  • 7. Which subatomic particle was discovered first?
    7·1 answer
  • What is the greatest challenge we face on earth?
    12·1 answer
  • Is bleaching hair a physical or chemical change
    12·1 answer
  • Solve these.. . . . .​
    13·1 answer
  • A __________________________ is an unmanned spacecraft that explores space by recording observations of temperature, radiation,
    12·2 answers
  • Water and carbon dioxide are both made of 3 atoms<br> True or false
    6·1 answer
  • A paragraph about Saturn.
    6·2 answers
  • In a radio, ______ energy is transformed into ______ energy.​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!