AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
It totally depends upon whether modification is being done in somatic cells or germ cells. Somatic cells modification is ethically accepted because it doesn't pass from one generation to another generation but germline modification is considered as unethical because the modification will pass on to the next generation leading to the persistence of modification in future generations. The problem with genetic modifications is that the impacts of modifications are unpredictable, rather than being fruitful they may lead to lethal mutations so if it occurs in just somatic cells, then even if it is lethal/harmful, it will be confined to only that individual but if a lethal mutation occurs in germ cells then it will pass on to the subsequent generations and it will persist in all future generations.
Answer:
Explanation:
Biogeochemical cycles represent the main system by which the energy of the Sun is transformed into energy of the chemical compounds by living beings and products of their activity. :)
Answer:
The genetic code has four main features: Three nucleotides/bases encode an amino acid, there are 20 different amino acids which are the building blocks for proteins. The genetic code is non-overlapping
Explanation:
Answer:
The correct answer is - B. disruptive selection.
Explanation:
Adaptive radiation is a type of genetic drift that relatively fast evolution of many species from a single common ancestor which means there is a big drift in a very small time.
Disruptive selection is a type of natural selection that shows phenotypes (individuals with groups of traits) of both extremes but has very few individuals in the middle. An example of this type is the evolution of mammals after the extinction of dinnosaurs.
