1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
14

Plz help mee......well mark brainliest!

Biology
2 answers:
bagirrra123 [75]3 years ago
8 0

Answer:

B) Herbivore

Explanation:

Virty [35]3 years ago
5 0

Answer:

Carnivore

Explanation:

You might be interested in
Protists can be harmful for which of the following reasons?
sergejj [24]

Answer:

The answer is both  the first (Cause disease) and second (Cause algal blooms)

Explanation:

Protists may cause disease and even kill living things. Also, algal blooms are essentially protists but have chloroplasts- which plays a part in them being harmful.

6 0
3 years ago
Read 2 more answers
Quais adaptações evolutivas o grupo das Angiospermas possui em relação aos outros grupos de plantas? Como essas adaptações contr
jolli1 [7]
Uhhh English or español please or por favor
5 0
2 years ago
Which statement best compares the moon and Earth?
AlexFokin [52]

Answer:

the moon is small and the erath is big also the earth has water and the moon dose not

7 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Ben had most of his stomach removed in an attempt for drastic weight loss.
irinina [24]

Answer: Option D.

Gastroesophageal reflux disease.

Explanation:

When a person stomach is removed by an operation called gastrectomy . The surgeon connects the oesophagus, a tube that runs from the throat to the stomach to the small intestine. When this happen , there will be acid reflux i.e acid flows back into the oesophagus and causes irritation of the food pipe or oesophagus, this is called Gastroesophageal reflux disease. This occur because there is no stomach where food will undergo some digestive process but in this case the food flows to the small intestine directly and can result in acid reflux

The symptoms of these are heartburn, chest pain, difficult in swallowing food, lump sensation in the throat e.t.c

8 0
4 years ago
Other questions:
  • Strep throat and bacterial pneumonia are examples of __________.
    7·2 answers
  • Hydrogen and carbon form non-polar bond. What relevance is<br> this<br> to living organisms?
    14·1 answer
  • Describe the relationship between science and technology, and give an example of how they are related.
    7·1 answer
  • A patient is admitted to the hospital with a diagnosis of abdominal aortic aneurysm. which signs and symptoms would suggest that
    15·1 answer
  • When an electric kettle containing cold water is switched on, the water in it starts boiling after a few minutes. What is the so
    14·1 answer
  • ILL MARK YOU BRIANLYEST
    13·1 answer
  • The new Hazard Communication Standards provide teachers and students the right to __________ chemical hazards.
    15·1 answer
  • If a person did not eat for serveral days, which sequence of events would occur
    10·1 answer
  • Explain how plasma membrane is involved in the process of endocytosis and exocytosis​
    13·1 answer
  • The connective tissue that surrounds and separates individual skeletal muscle fibers (cells) is called:_________
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!