1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
3 years ago
9

How do scientist use layers of rock to determine when the Great Oxidation event occured?

Biology
1 answer:
Oksanka [162]3 years ago
8 0

Answer:

Using the concept of relative dating

Explanation:

Scientists use the concept of relative dating principles to determine when the Great Oxidation event occurred.

Relative dating is the process of placing ancient event in their proper time sequence based on the relationship between rock lithologies.

  • An event like the great oxidation will have significant chemical, biological and physical effect on the rock units.
  • Rocks that form during this period in time will have very unique chemical signatures.
  • Therefore, by studying these rocks, the age of the layer can be fixed when we compare it to the standard geological column.
You might be interested in
Two solutions of water and dissolved potassium and glucose are separated by a selectively permeable membrane that only permits t
anzhelika [568]

Answer:

. there will be no net movement of water molecules between the solutions

Explanation:

osmosis

3 0
3 years ago
Apply concepts How did you know which bases to use when you transcribed the DNA sequence to mRNA codons?
allsm [11]

In transcription, the mRNA strand is formed by complementary base pairing of the template DNA strand. However we should note that the nitrogenous bases in mRNA are Adenine, Guanine, Cytosine and

Uracil

, while those in DNA are Adenine, Guanine, Cytosine and

Thymine

.

So the mRNA strand would be formed by matching the

A in DNA with U in mRNA

,

T in DNA with A in mRNA

,

C in DNA with G in mRNA

and

<span>G in DNA with C in mRNA</span>

7 0
3 years ago
Select all that apply
monitta
Transports, deposits
6 0
3 years ago
Read 2 more answers
In an eight–cell embryo of an organism, the cells of the upper tier are aligned directly over the cells of the lower tier. Which
IgorC [24]
The answer is starfish!
8 0
3 years ago
How does the hydrosphere affect the atmosphere?​
horrorfan [7]

Answer:

so when pure water vapor from the water bodies get absorbed into polluted gases in the atmosphere, acid rain is caused and when this happens in a place where an element of the hydrosphere is located, it is polluted.

Explanation:

7 0
3 years ago
Other questions:
  • What would be a major sign of overtraining? change in appetite decrease performance loss of motivation and vigor disturbed sleep
    6·1 answer
  • How do you do this?‍♀️
    13·1 answer
  • What negative affects do humans have on the earths oceans
    11·1 answer
  • The sodium-potassium pump is called an electropenic pump because it A) pumps electrons across the plasma membrane B) pumps hydro
    6·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Do you recall any vertebrates with external reproductive organs on their dorsal surface? What advantages or
    5·1 answer
  • Please help
    9·1 answer
  • 2 heavy objects close together • 2 light objects far apart • 1 light item and 1 heavy item a medium distance apart
    8·1 answer
  • N 2000, Bob Harmon discovered the best-preserved Tyrannosaurus rex skeleton ever found. The fossilized dinosaur was sticking out
    9·1 answer
  • Which body system is most responsible for the removal of waste?.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!