1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wariber [46]
3 years ago
7

Selective permeability means that specific molecules or ions can move through the cell membrane by passive transport or active t

ransport as seen with
Biology
1 answer:
Dafna1 [17]3 years ago
6 0

Answer:

With microscope.

Explanation:

Every cell has a selective permeable membrane in which smaller molecules can pass whereas bigger molecules stays outside the cell which can be seen in the cell with the use of microscope because it only occurs inside the cell. The movement of ions or molecules in the cell through a semi permeable membrane is called Osmosis. The movement of ions or molecules sometime needs energy we called it active transport and sometimes it moves without the use of energy is known as passive transport.

You might be interested in
What type of RNA is a major component of the structure at which protein synthesis occurs?
Ainat [17]
The answer is, "B", "Ribosomal RNA".
5 0
3 years ago
Read 2 more answers
Patty (age 7) has symptoms that include a skin rash, fever slowed growth, fatigue, and swelling in the joints. she was diagnosed
mafiozo [28]

Patty (age 7) has symptoms that include a skin rash, fever slowed growth, fatigue, and swelling in the joints. She was diagnosed as having juvenile rheumatoid arthritis.

What is juvenile rheumatoid arthritis described as?

Juvenile rheumatoid arthritis is the most common kind of arthritis in children. It is characterized by heat and discomfort and causes the joints to expand. The duration of acute arthritis can range from a few weeks or months to years or even a lifetime. It can also be persistent. IA types include autoimmune and autoinflammatory illnesses. This suggests that the immune system, which is meant to fight off viruses and pathogens, becomes confused and attacks the body's cells and tissues. The doctor can suggest blood testing for C-reactive protein and erythrocyte sedimentation rate. These blood tests evaluate inflammatory markers or markers of inflammation.

To learn more about Juvenile rheumatoid arthritis, click below

brainly.com/question/13158067

#SPJ4

6 0
2 years ago
Please help me asap​
GaryK [48]

Answer:

answer is asteroids and comets

Explanation:

Planets and Meteors: a planet is far larger than a meteor

Moons and Meteors: a moon is larger than a meteor

Comets and planets: a planet is far larger than a comet

6 0
3 years ago
Some teachers explain thAT meiosis is actually appening twice.is tat the correct assumption
sergij07 [2.7K]
Yes. It can happen twice! 
8 0
3 years ago
Suggest why an MRSA infection may have to be treated with many different antibiotics
schepotkina [342]

Answer:

A trio of antibiotics that had become powerless against MRSA decades ago proved effective in infected mice when used together.

Although more testing is needed, the results suggest that combinations of already-approved antibiotics might add to our options to combat MRSA infections.

Explanation:

3 0
3 years ago
Other questions:
  • What relationship exists between nutrients and biomolecules?
    5·2 answers
  • Mitochondrial DNA accumulates DNA mutations quickly. Because of this, it would be most beneficial in analyzing the ancestral rel
    8·1 answer
  • The two nutrients that typically limit primary productivity of ecosystems are phosphorus and __________. A. calcium B. carbon C.
    9·1 answer
  • Explain in detail the difference between kinetic and potential energy.
    13·2 answers
  • Two lines perpendicular to one another can represent a _____-dimensional coordinate system.
    7·2 answers
  • On the pH scale what results means the water is acidic 9.2, 7.0, 3.2, 10.0?
    10·1 answer
  • Which of the following is true about scientific knowledge?
    12·2 answers
  • How is it possible to explain one parent with curly hair, one parent with straight hair, and
    8·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Nitrogen from animal wastes or plant an animal tissue
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!