1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
9

The diagram below shows a stack of rock layers. These layers have not changed position since they formed. Examine the diagram an

d answer the question that follows. If the age of Layer 4 is 400 million years and the age of Layer 1 is 500 million years, then the age of Layer 3 is A. older than 500 million years. B. between 400 million and 500 million years. C. 500 million years. D. younger than 400 million years.
Biology
2 answers:
Fudgin [204]3 years ago
7 0

Answer:

B. between 400 million years and 500 million years (assuming that layer 3 is in between layer 1 and 4)

Explanation:

marissa [1.9K]3 years ago
3 0
This answer is 500 million year hope I helped
You might be interested in
Which natural events likely caused Earth's past mass extinctions?
adelina 88 [10]
In my opinion

Mass extinctions happen because of climate change, asteroid impacts, massive volcanic eruptions or a combination of these causes. One famous mass extinction event is the one that lead to the extinction of dinosaurs, 65 million years ago.
I hope it’s help
7 0
3 years ago
Read 2 more answers
Clout gang I neeeed helpppppppppp
Leona [35]
<span>
What do you think that a very wide space between two contour lines means?


</span><span> B.MOUNTAIN TOP</span>
7 0
3 years ago
Do you think osmosis occurs when a cell is in an isotonic solution explain your reasoning
Bumek [7]
The word isotonic is used to refer to the solutions (two solutions) which have the same osmotic pressure in both sides of the semipermiable membrane. The condition allows the free movement of water across the membrane. However, this does not change the concentration of the solution across the membrane. 

Hence, osmosis may not occur in this condition. 
3 0
3 years ago
¿Todas las venas conducen sangre pobre en oxigeno?
Amanda [17]

Answer:

El aparato circulatorio unidireccional transporta sangre a todas las partes del cuerpo. Este movimiento de la sangre dentro del cuerpo se denomina «circulación». Las arterias transportan sangre rica en oxígeno del corazón y las venas transportan sangre pobre en oxígeno al corazón.

Explanation:

4 0
2 years ago
All the animals can be classified into three groups ____,_____,______on the basis of
In-s [12.5K]

Answer:

Herbivores, Carnivores, Omnivores

plz mark me as brainliest.

4 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP I'M STUCK AND I'LL GET A 0 !What do Carnivores consume?why might carnivores be called Secondary consumers?(I'm givin
    5·2 answers
  • A decrease in the oxygen-carrying ability of the blood, for any reason, is a condition known as ________.
    5·1 answer
  • Mixed cranial nerves containing both motor and sensory fibers include all except _________
    13·1 answer
  • What structural feature do epithelia that provide for protection have in common?
    8·1 answer
  • What is fruiting body in agaricus called?​
    10·2 answers
  • What helps the recycling of nutrients in an ecosystem by consuming dead organic material
    13·1 answer
  • What are you testing for when you use lugols solution
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Homeostasis depends on the activity of body systems to adjust a variable. Because our bodies work so well to maintain variables
    9·1 answer
  • Why do scientists prefer to have more than one theory about something
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!