Answer:
Serine
Explanation:
The genetic code indicates the way by which the four bases of the messenger RNA (i.e., Adenine, Uracil, Guanine and Cytosine) are read in the ribosome to convert them into a protein. In this code, each codon is composed of three nucleotides that encode a single amino acid. Serine (S) residue can be synthesized by AGC (as in this case), AGU, UCA, UCC, UCG and UCU codons. The sequence above indicated (AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA) will be traduced in the following 5'-3' Frame: S-WAGAEKVR-, where the second codon is a stop codon (UGA).
Answer with Explanation:
The capillary rise in 2 parallel plates immersed in a liquid is given by the formula
where
is the surface tension of the liquid
is the contact angle of the liquid
is density of liquid
'g' is acceleratioj due to gravity
'd' is seperation between thje plates
Part a) When the liquid is water:
For water and glass we have
Applying the values we get
Part b) When the liquid is mercury:
For mercury and glass we have
Applying the values we get
The negative sign indicates that there is depression in mercury in the tube.
Answer:
500 N
Explanation:
Given;
Mass of the car, M = 1000 kg
initial speed of the car, u = 0 m/s
Final speed of the car, v = 60 m/s
Time, t = 1 min = 60 s
Now,
Force, F is given as:
F = Ma
where,
a is the acceleration
From the Newton's equation of motion, we have
v = u + at
on substituting the values, we get
60 = 0 + a × 60
or
a = 1 m/s²
Thus,
Force = 1000 × 1 = 1000 N
now,
this force will be equal to the friction force provided by the rear wheels
let the friction force on a single rear wheel be 'f'
thus,
2f = 1000 N
or
f = 500 N
Answer:
An opamp is an operation amplifier. It takes an input signal and amplifies it on the output side.
An ideal opamp should have infinite impedance at its input, infinite gain on the output, and zero impedance on the output
Answer:
Explanation:
The turbine is modelled after the First Law of Thermodynamics:
The rate of heat transfer between the turbine and its surroundings is:
The specific enthalpies at inlet and outlet are, respectively:
The required output is: