1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Doss [256]
2 years ago
5

What is a phytoplankton? If yall searching it up it non-correct

Biology
1 answer:
PSYCHO15rus [73]2 years ago
3 0

Answer:

Phytoplankton is an organism that contains chlorophyll. I think phytoplankton is a microscopic plant-like organism that lives in water and gets its energy from the sun.

Explanation:

Note: I'm not an expert about phytoplankton. I'm just someone who knows it's a microscopic organism that usually lives in water and gets its energy from the sun.

Hoped this helped.

You might be interested in
Which structure best makes Bermudagrass successful in preventing soil erosion
valentina_108 [34]

Bermuda grass is successful in preventing soil erosion because the roots of the Bermuda grass can grow deep and it can reach 6 feet deep more on its surface. Also when the Bermuda grass is damaged it can grow back quickly. 

7 0
3 years ago
The Eurasian water milfoil is a nonnative
Mashutka [201]
The right answer for the question that is being asked and shown above is that: "(4) the introduction of a species that has increased the long-term biodiversity of an ecosystem." This plant ruins fishing areas and interferes with boating and other water sports. This is an example of the introduction of a species that has increased the long-term biodiversity of an <span>ecosystem</span>
6 0
3 years ago
The observation that members of a population are uniformly distributed suggests that A. resources are distributed unevenly. B. t
ANEK [815]

The observation that members of a population are uniformly distributed suggests that   the members of the population are competing for access to a resource.

Option B is correct.

What is a resource ?

A resource is any physical material constituting a part of Earth that people need and value. Natural materials become resources when humans value them. The uses and values of resources change from culture to culture and from time to time. Resources are spatially distributed varying in quantity and quality.

Why the resources are important?

Resources are necessary for citizenry because of the following reasons: Resources when used as a raw material satisfy the needs and comforts of human beings. Natural resources are a source of agricultural activities which adds to the economic importance. They also provide employment opportunities.

Learn more about resource :

brainly.com/question/24514288

#SPJ4

5 0
1 year ago
All of the statements about bacteria are true EXCEPT one. Which statement is not true?
Goryan [66]
Well whats the answer?


7 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Which statement regarding sex chromosome abnormalities is incorrect?
    7·1 answer
  • true or false: a phenotype describes the physical expression (characteristics) of a gene. In other words, how something looks.
    11·1 answer
  • What is a supercell???
    11·2 answers
  • The spinal cord is part of which nervous system? Question 3 options: 1) sympathetic 2) autonomic 3) parasympathetic 4) central 5
    12·1 answer
  • Earthworms, which are land invertebrates, and caecilians, which are amphibians, have evolved with traits that enable them to bur
    13·2 answers
  • Great amount of electromagnetic energy from sun and other bodies in space travel through space. Which is a logical conclusion ab
    14·1 answer
  • Which climate zone would the location on this map be at 40 N and 60N?Hint:ohio is in the zone
    8·2 answers
  • A bog is a type of wetland with witch of the following
    10·1 answer
  • Coal can be described as *
    8·1 answer
  • If you wanted to design a tissue that restricted the movement of water and other molecules between adjacent cells, which type of
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!