1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
2 years ago
14

4. What term describes the reactants that an enzyme acts on?

Biology
2 answers:
kakasveta [241]2 years ago
4 0
PLS help ASAP I DONT have time to answer this, it also detects if it’s right or wrong. PLS help ASAP I DONT have time to answer this, it also detects if it’s right or wrong. PLS help ASAP I DONT have time to answer this, it also detects if it’s right or wrong. PLS help ASAP I DONT have time to answer this, it also detects if it’s right or wrong. PLS help ASAP I DONT have time to answer this, it also detects if it’s right or wrong. PLS help ASAP I DONT have time to answer this, it also detects if it’s right or wrong.
Nady [450]2 years ago
3 0
The specific reactants that an enzyme acts on are called substrates. they temporarily bind to enzymes at specific places called active sites.
You might be interested in
What happens when a neurotransmitter receptor site becomes flooded?
Elodia [21]

Answer:

a neurotransmitter binds to its receptor on a receiving cell

Explanation:

4 0
3 years ago
What does the word Immigrant mean to you?
iragen [17]

Answer:

someone who moved from a different country looking for job opportunities

Explanation:

6 0
3 years ago
Could the people of a culture eat a diet that is normal for their culture if they were following the scientist-designed Kemper d
Sauron [17]

Answer:

Yes.

Explanation:

Yes, the people of a culture can eat a diet that is normal for their culture if they want to follow the Kemper diet because there are a lot of natural foods are present in the culture. Kemper's diet is heavy on fruits and vegetables and relies on natural foods so the people has a large number of natural foods in their culture so by eating that natural foods they can follow the Kemper diet.

7 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Use the following terms in the same sentence: growth rate, birth rate, death rate, emigration and immigration.
Nadya [2.5K]

The growth rate of Earth is decreasing, as the birth rate is the main source. The death rate is mostly abortion which tyes in with birth rate. Much types of emigration have been seen. Mostly Asians, because most asian countries only want the boys and not the girls. Trump is thinking of making a wall to stop mexican immigration.

5 0
2 years ago
Other questions:
  • In this section, please include the if/then statements you developed during your lab activity. These statements reflect your pre
    11·2 answers
  • Is air pollution from a factory a change to an organism’s abiotic environment or biotic environment?
    6·1 answer
  • Which of the following are secondary minerals found in soils?
    15·1 answer
  • I need help with 4.b please
    8·1 answer
  • Which statement explains why earthquakes tend to be deeper near subduction zones?
    9·1 answer
  • What molecule holds the nitrogen bases together in the DNA twisted configuration?
    9·1 answer
  • Epistasis is where one gene hides the effects of another gene. In labrador dogs, the dominant allele (E) determines whether the
    12·1 answer
  • Water is denser than isopropanol, so the water layer will always be below the isopropanol layer if they are both in the same con
    13·1 answer
  • HELp‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️‼️
    11·1 answer
  • What do you think caused people to accept the heliocentric model of the solar system?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!