1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuki888 [10]
3 years ago
7

Please help❤️ Explain what is meant by noble gas envy.

Chemistry
1 answer:
Bumek [7]3 years ago
8 0

Answer:

a phrase that describes how elements what do be stable and non reactive like the noble gas elements are.

You might be interested in
Help ASAP!
ipn [44]

I believe the answer is D

5 0
3 years ago
I am a nonmetal.I am in the Oxygen family and in row 3.I have 6 valence electrons.I am yellow and have a stinky smell.Who am i
Dimas [21]

Answer:

sulfur

Explanation:

In oxygen family sulfur has yellow color and also having stinky smell. Thus given statements are about sulfur.

It is present in oxygen family.

It has six valance electrons.

Its atomic number is 16.

Its atomic weight is 32 amu.

The electronic configuration of sulfur is given below,

S₁₆ = 1s² 2s² 2p⁶ 3s² 3p⁴

We can see the valance shell is third shell and it have six electrons thus sulfur have six valance electrons. (3s² 3p⁴ )

Sulfur is used in vulcanisation process.

It is used in bleach and also as a preservative for many food.

it is used to making gun powder.

8 0
3 years ago
5. Can you determine the number of neutrons in the nucleus of an atom by looking at the element's average atomic mass and the at
Shkiper50 [21]

Answer:

No you can't

Explanation:

The atomic number is the amount of protons in element's nucleus, that's one reason why. The second reason is that the atomic mass is protons and neutrons combined, their estimated value, which doesn't show how much neutrons are in an element. It does show combined, but not specifically neutrons

7 0
2 years ago
3. Scientific methods may include three steps of study as listed below. Explain each step in detail with a complete content rela
victus00 [196]

Answer:

Hypothesis is an assumption or idea about a particular topic or argument. An hypothesis should be one which is able to be tested and measurable to determine its authenticity.

A theory is an explanation of a scientific observation which has undergone series of experiments and is reproducible in any part of the world.

A law is simply a rule which gives an in depth explanation of a scientific finding. If new findings emerge the law could be changed or modified.

8 0
3 years ago
WHAT IS THE PH OF LEMON JUICE IF IT HAS A HYDROGEN ION CONCENTRATION [AT]ON[H^ + ]=5.0*10^ -2 M.
stellarik [79]

Answer:

ph=2

Explanation:

8 0
3 years ago
Other questions:
  • Which two elements have the same number of valence electrons?
    15·2 answers
  • 2000 joules are required to heat 125 grams of an unknown substance from 10 c to 28 c. What is the specific heat of the substance
    7·1 answer
  • Uncooked lean ground beef can contain up to 12% fat by mass. How many grams of fat would be contained in 0.97 lbs of ground beef
    11·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which form of energy is associated with the random motion of the particles in water
    11·1 answer
  • Draw a mechanism for the reaction of the aldehyde with hydronium ion. In the first box, draw any necessary curved arrows. Show t
    11·1 answer
  • A pain-relieving pill has a mass of 0.005 g. Express the pill’s mass in grams using scientific notation or in milligrams.
    11·1 answer
  • 1. The Yerkes-Dodson Law says
    12·1 answer
  • Which of the following can be represented by a single chemical symbol?
    11·1 answer
  • Water is stored where until it is used by the cell
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!