1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zimovet [89]
3 years ago
11

What is a organelle? Give an example(if you can)​

Biology
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body.

Explanation:

Some examples of organelles are endoplasmic reticula, Golgi apparatus, lysosomes, vacuoles, mitochondria, plastids, and nucleus.

You might be interested in
Which organelles allow plants to support heavy structures such as leaves and flowers?
son4ous [18]

Answer:

I believe the answer is C

Explanation:

In many plant cells there is a single large central vacuole filled with liquid, pressure of the central vacuole allows plants to support heavy structures such as leaves and flowers.

8 0
2 years ago
Read 2 more answers
The three main types of articulations within the human body are
Zepler [3.9K]

Answer:

A. fibrous, cartilaginous, and synovial.

Explanation:

hope this helps!

4 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Do hawks eat spiders?
erik [133]

Answer:

Yes

Explanation:

6 0
3 years ago
Read 2 more answers
What are some good and bad results on irradiation being used on seeds
malfutka [58]

Explanation:

The effects of gamma radiation are investigated by studying plant germination, growth and development, and biochemical characteristics of maize. Maize dry seeds are exposed to a gamma source at doses ranging from 0.1 to 1 kGy. Our results show that the germination potential, expressed through the final germination percentage and the germination index, as well as the physiological parameters of maize seedlings (root and shoot lengths) decreased by increasing the irradiation dose. Moreover, plants derived from seeds exposed at higher doses did not survive more than 10 days. Biochemical differences based on photosynthetic pigment (chlorophyll a, chlorophyll b, carotenoids) content revealed an inversely proportional relationship to doses of exposure. Furthermore, the concentration of chlorophyll a was higher than chlorophyll b in both irradiated and non-irradiated seedlings. Electron spin resonance spectroscopy used to evaluate the amount of free radicals induced by gamma ray treatment demonstrates that the relative concentration of radiation-induced free radicals depends linearly on the absorbed

8 0
2 years ago
Other questions:
  • Select the definition of aneuploidy.
    13·1 answer
  • what are the three properties of components of the universe that can be determined using electromagnetic radiation
    10·1 answer
  • Biodiversity enhances ________ because it provides genetic diversity and the potential for developing more productive food crops
    5·1 answer
  • In humans if a trait is passed on the X chromosome then the trait is
    8·1 answer
  • Many plant species are "winter annuals" - their seeds germinate in summer, and the plants grow vegetatively in fall and are dorm
    15·1 answer
  • A group of biology students tests the growth of bacteria under different conditions. The students apply the same amount of bacte
    8·2 answers
  • How many atoms are in one cell
    11·2 answers
  • WILL MARK BRAINLIEST!
    9·1 answer
  • What factors affect a person's memory and their ability to<br> identify a suspect?
    10·1 answer
  • Which types of cells do not reproduce and, if damaged by injury or disease, are lost forever?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!