1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
insens350 [35]
3 years ago
5

What is the difference between a Prokaryotic and Eukaryotic cell? In your own words please

Biology
1 answer:
valentinak56 [21]3 years ago
7 0

Answer:

Prokaryotic are organisms that consist of a single prokaryotic cells and Eukaryotic cell are found in plants, animals, fungi and protists.

Explanation:

they are range from 10-100 micrometre in diameter, and their DNA is contained within a membrane-bound nucleus.

You might be interested in
Nitrogen is one the important elements for life. Nitrogen is present in dna and proteins.
ryzh [129]

Answer:

This is anmy science question so you can see this answer from meritnation

Explanation:

5 0
3 years ago
1. Which sequence places the steps in the correct order? 1. Transfer RNA picks up individual amino acids and carries them to the
kotykmax [81]

Answer:

I think if in order 1 3524

Explanation:

7 0
3 years ago
How many NEUTRONS does an element have if it’s atomic number is 44 and it’s mass number is 154 ?
krek1111 [17]

If the element has a atomic number of forty-four then the amount of neutrons would be "fifty-seven." This element is actually called Ruthenium and it has forty-four protons, and electrons, and it has fifty-seven neutrons and you can determine this by using this equation then solve:

44 + N = 101

= 57

Hope this helps!

6 0
3 years ago
Put the following events in the order that they occur for a digital recording to become sound waves through a speaker
dlinn [17]

Answer:

1) sound is encoded on a digital recording as an electrical signal.

2) the digital recording plays the sound as an electrical signal.

3) the electric signal moves through a voice coil

4) The voice coil produces a magnetic field.

5) changing the magnetic field pushes and pulls on the diaphragm.

6 0
3 years ago
the sodium-potassium pump uses energy from atp to move sodium ions out of the cell, and potassium ions into the cell. this is an
vlada-n [284]

Answer:

active transport

Explanation:

it involves movement of ions

3 0
2 years ago
Other questions:
  • Butterflies and house flies convert ammonia to uric acid in their
    15·1 answer
  • Which of the following activities contribute most to climate change?
    8·2 answers
  • During assessment, a patient states, "i don't know why god is punishing me like this." which nursing diagnosis would the nurse m
    15·1 answer
  • What metal is is usually used for wires in electric circuits
    13·1 answer
  • A patient has diabetes, a disease that causes high blood sugar levels. Which macromolecule will a dietician monitor most closely
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What will happen if Paramecium Sp is exposed to sunlight​
    11·2 answers
  • What evidence shows that biological molecules on earth form naturally?
    14·1 answer
  • Please guys, can someone please help me?
    9·2 answers
  • Which shows the levels of organization within an ecosystem from largest to smallest?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!