I think B is the answer The Clean Air Act That prevented air pollution and protected the ozone layer as well as promote public health. This act gave Enviromen. Protection Agency the power to take effective action fighting environmental air pollution
Answer:
Mike ghost hunting glitchy jumbo doctor
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The ribosomes cause the outer surface of the rough endoplasmic reticulum to appear rough.
That would be false. The Ozone layer is what protects Earth from UV radiation. The Ozone is part of the Stratosphere.
