1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dimaraw [331]
3 years ago
13

Explain what happens to heat during the Greenhouse effect. Why does this happen?

Biology
1 answer:
Flura [38]3 years ago
4 0

Answer:

The greenhouse effect is a natural phenomenon that causes the surface of the Earth to steam. When sunlight strikes the Earth's atmosphere, part of it is reflected back to space, while the remainder is absorbed and re-radiated by greenhouse gases.

Explanation:

Hope this helps!

Please mark me as Brainlinieast.

You might be interested in
Need an answer now explain answer the 1-4 questions ​
guajiro [1.7K]

Answer:

yes it is true

Explanation:

my hand

7 0
3 years ago
Read 2 more answers
The microorganisms commonly found on the human skin are known as ______?
nekit [7.7K]
C are you dum
Yes this is so easy give me brainiest
8 0
2 years ago
The suffix -plasm means
melamori03 [73]

D. Growth. Material forming cells or tissue like cytoplasm.

7 0
3 years ago
To best display the distribution of sex (male, female, other), we could use:
topjm [15]

Answer:

<em>i</em><em> </em><em>gu</em><em>ess</em><em> </em><em>it</em><em>'s</em><em> </em><em>gender</em>

<em>hop</em><em>e</em><em> this</em><em> helps</em>

6 0
3 years ago
Transverse waves contain _____ &amp; _____, while longitudinal waves contains ______ &amp; _________.
nlexa [21]

Transverse waves contain crests & troughs

while longitudinal waves contains compressions &rarefactions.

4 0
3 years ago
Other questions:
  • Which point in the water cycle best illustrate water changing to a gas and which terms could describe it
    12·1 answer
  • A client was seen in the clinic for musculoskeletal pain, fatigue, mood disorders, and sleep disturbances. the physician has dia
    6·1 answer
  • What is an effect of a compromised immune system?
    11·2 answers
  • 3. Below is a list of components that can make up a number of different systems:
    14·2 answers
  • The endocrine system regulates the body through hormone release. Like the nervous system, what does the endocrine system help ma
    6·1 answer
  • Difference between eukaryotic cells and prokaryotic cells.​
    8·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What is the difference between animal and plant cells?
    15·1 answer
  • A teacher showed this animal to students on a field trip. Which tool will the students use to record the animal's behavior? A. G
    8·1 answer
  • The mature cells that live in cartilage and maintain the matrix around them are.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!