1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
3 years ago
6

- All the metals of group 1 react with water, liberating hydrogen gas and forming metal

Chemistry
2 answers:
IRISSAK [1]3 years ago
6 0

Answer:

since it is in grp 1, it will react with water like all other metals.

lys-0071 [83]3 years ago
4 0

Answer:

Rubidium, as a Group 1 metal, will have a strong reaction with the water and form hydrogen. The reaction is so strong it might even be explosive, hence the danger of putting it in water.

Explanation:

Hope this helped!

You might be interested in
NEED HELP PLEASE!!!!
Feliz [49]
I think the correct answer would be the third option. The reason I2 has a higher melting point than F2 is because I2 possesses a more polarizable electron cloud. I2 contains more electrons than F2 which would result to a stronger intermolecular forces. Having stronger intermoleculer forces would mean more energy is needed to break the bonds so a higher melting point would be observed.
4 0
3 years ago
The Earth's moon is unusually large. Two popular theories of the moon's origin include the "sister world" hypothesis, which stat
Verizon [17]

Answer: D. They show that neither theory is complete and entirely correct.

Explanation:

Theory is the set of rules and principles that describe and explain a particular phenomenon (the existence of the moon in this case) and is subject to changes as new evidence emerges that gives meaning to it.

In this sense, there are many theories about the Earth's moon formation and two of the "accepted" theories are described before the question. In addition, both theories explain in a certain way the reason why the Moon is predominantly composed of elements similar to those found on Earth.

However, both theories seem to be incomplete when trying to explain our Moon's origin.

8 0
3 years ago
Read 2 more answers
During an experiment, a scientist places a heat lamp above a bowl of water and uses the lamp to heat up the water. How does heat
dlinn [17]

Answer:

Radiation

Explanation:

6 0
3 years ago
Read 2 more answers
Why are the wind speeds on gas giant planets so much greater than the wind speeds on earth?
Flura [38]
<span> reason is that there is no land to slow down the wind. Also, wind is caused by differences in air pressure</span>
8 0
3 years ago
A laboratory experiment requires 2.25 L of a 1.0 M solution of phosphoric acid (H3PO4), but the only available H3PO4 is a 9.0 M
Ksenya-84 [330]
The solution needed is prepared  as below

by use of the   M1V1 =M2 V2  formula  where
M1 = 2.25 L
v2 = 1.0M
M2 = 9.0 M
V2 =? l

make V2  the subject of the formula  V2 =M1V1/M2

= 2.25 L x  1.0M/9.0 M  = 0. 25 L

therefore  the solution  need  0.25 L  of   9.0M H3PO4   and  dilute it a final volume  of 2.25 l 
6 0
3 years ago
Read 2 more answers
Other questions:
  • Convert 1.6 x 10^-20 moles of Titanium to g mole <br> how many atoms of Ti do you have?
    11·1 answer
  • How many kilometers are there in 4.5 x 10^3 meters ?
    13·1 answer
  • If you are pulling on a box with a force of 30 N, and your friend is pushing the box in the same direction with a force of 30 N,
    10·1 answer
  • The independent variable has control and affects the
    5·2 answers
  • A student wants to do scientific research on how aquatic plants in lakes have changed over time. What field of science does this
    15·1 answer
  • Which reaction will most likely take place based on the activity series? Li &gt; K Ba CaNa &gt; Mn &gt; Zn &gt; Cr&gt; Fe&gt; Cd
    5·1 answer
  • The diagram shows a model of the nitrogen cycle. which role do plants play in the nitrogen cycle?
    11·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • True or False: Rubbing a balloon on your head for a longer amount of time will increase the attractive force of the balloon.​
    9·1 answer
  • How many atoms are present in 0.529 moles of Li?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!