3 years ago

Just need help with this last question

Chemistry

2 answers:

uranmaximum [27]3 years ago

6 0

Answer:

Explanation:

Potential energy is obtained by an object's positioning so the first and last choice cannot be correct.

Of course the electrical energy is not destroyed so that one's not correct either.

The energy conversion that takes place must be electrical energy to light and heat.

ella [17]3 years ago

5 0

its electrical energy -------> light and heat

Hope this helps

mark brainliest if helpful

You might be interested in

Which is the answer please help

djyliett [7]

Answer:

The outermost energy shell of an atom likes to be full with 8 electons

Explanation:

4 0

3 years ago

Read 2 more answers

What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

3 years ago

The photo shows a clay pot being made on a spinning potter's wheel. What

sineoko [7]

Answer:B

Explanation:

7 0

3 years ago

For each pair below, select the sample that contains the largest number of moles. Pair A 2.50 g O2 2.50 g N2

raketka [301]

Answer:

Explanation:

Pair 2.50g of O₂ and 2.50g of N₂

The atoms sample with the largest number of moles since the masses are the same would be the one with lowest molar mass according the the equation below:

Number of moles = $\frac{mass }{molarmass}$

Atomic mass of O = 16g and N = 14g

Molar mass of O₂ = 16 x 2 = 32gmol⁻¹

Molar mass of N₂ = 14 x 2 = 28gmol⁻¹

Number of moles of O₂ = $\frac{2.5}{32}$ = 0.078mole

Number of moles of N₂ = $\frac{2.5}{28}$ = 0.089mole

We see that N₂ has the largest number of moles

4 0

3 years ago

Read 2 more answers

Which planet in our solar system is closest to the sun?

Dafna11 [192]

The answer is c)mercury

4 0

3 years ago