1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GrogVix [38]
3 years ago
14

Show proof for brainliest(not suggested but i wanna know how you got your answer) i will give you 5 stars and brainliest:)

Chemistry
1 answer:
Nastasia [14]3 years ago
3 0

Answer:

More oxygen is needed to produce more energy, and more carbon dioxide waste must be removed from the body.

Explanation:

Oxygen helps our cells work harder by breaking down the nutrients we get from food like sugars. With sugars and oxygen, our cells can create the energy they need to function. This process also produces carbon dioxide. The carbon dioxide produced is a waste product and needs to be removed. During exercise, your body needs more energy, which means your tissues consume more oxygen than they do at rest. Consuming more oxygen means you will also produce more carbon dioxide because your metabolic rate is elevated. The lungs and respiratory system allow oxygen in the air to be taken into the body, while also letting the body get rid of carbon dioxide in the air breathed out. When you breathe in, the diaphragm moves downward toward the abdomen, and the rib muscles pull the ribs upward and outward.

You might be interested in
State the law of multiple proportions.
Fofino [41]
Statement that when two elements combine with each other to from more than one compound, the weights of one element that combine with a fixed weight of the other are in a ratio of small whole numbers.
8 0
3 years ago
Read 2 more answers
Not able to be separated by physical means but is chemical what is it
Ray Of Light [21]
My science text book said that it was either diamond or gold.  Gold may not be right, but I am pretty sure diamond is.

Sorry if I got this wrong.
8 0
3 years ago
Design a test to determine whether thorium-234 also emits particles. First, explain how Rutherford’s experiment measured positiv
liubo4ka [24]

The characteristics of the α and β particles allow to find  the design of an experiment to measure the ²³⁴Th particles is:

  • On a screen, measure the emission as a function of distance and when the value reaches a constant, there is the beta particle emission from ²³⁴Th.
  • The neutrons cannot be detected in this experiment because they have no electrical charge.

In Rutherford's experiment, the positive particles directed to the gold film were measured on a phosphorescent screen that with each arriving particle a luminous point is seen.

The particles in this experiment are α particles that have two positive charge and two no charged is a helium nucleus.

The test that can be carried out is to place a small ours of Thorium in front of a phosphorescent screen and see if it has flashes, with the amount of them we can determine the amount of particle emitted per unit of time.

Thorium has several isotopes, with different rates and types of emission:

  • ²³²Th emits α particles, it is the most abundant 99.9%
  • ²³⁴Th emits β particles, exists in small traces.

In this case they indicate that the material used is ²³⁴Th, which emits β particles that are electrons, the detection of these particles is more difficult since it has one negative charge, it has much lower mass, but they can travel further than the particles α, therefore, for what type of isotope we have, we can start measuring at a small distance and increase the distance until the reading is constant. At this point all the particles that arrive are β, which correspond to ²³⁴Th.

Neutron detection is much more difficult since these particles have no charge and therefore do not interact with electrons and no flashing on the screen is varied.

In conclusion with the characteristics of the α and β particles we can find the design of an experiment to measure the ²³⁴Th particles is:

  • On a screen, measure the emission as a function of distance and when the value reaches a constant, there is the β particle emission from ²³⁴Th.
  • The neutrons cannot be detected in this experiment because they have no electrical charge.

Learn more about radioactive emission here: brainly.com/question/15176980

7 0
2 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Why is it important to monitor pH levels in natural bodies of water?
AleksandrR [38]

Answer:

Since pH can be affected by chemicals in the water, pH is an important indicator of water that is changing chemically

Explanation:

pH is really a measure of the relative amount of free hydrogen and hydroxyl ions in the water. Water that has more free hydrogen ions is acidic, whereas water that has more free hydroxyl ions is basic

3 0
3 years ago
Read 2 more answers
Other questions:
  • The surface of water can act like a sort of skin due to a property of liquids called
    9·2 answers
  • On a shade-grown coffee plantation, smaller coffee plants grow in the shade of forest trees. The practice produces fewer coffee
    14·2 answers
  • A bag of fertilizer is labeled 10-20-20. What is the actual percentage of phosphorus in the fertilizer?
    10·1 answer
  • In his experiment on spontaneous generation, Louis Pasteur changed only one thing between his experimental groups: whether or no
    13·1 answer
  • Describe the difference between a. a hypothesis and a theory and b. an observation and an experiment.
    9·1 answer
  • ANSWER THE QUESTION BELOW FOR BRAINLEST AND 10 POINTS
    9·2 answers
  • Write complete electron configuration for each of the
    8·1 answer
  • There are 235.5 grams of Calcium chloride dissolved in 2.5 liters of solution. What is the molarity of
    12·1 answer
  • How many liters are equal to 8 megaliters (ML)?
    10·1 answer
  • Which of these electron transitions correspond to absorption of energy and which to emission?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!