1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
2 years ago
9

Need the answer ASAP thanks

Biology
1 answer:
Illusion [34]2 years ago
6 0

Answer:

kingdom, division, class, order, family, genus, species.

Explanation:

You might be interested in
Ocean coring:
Sever21 [200]
I believe that it is used to study the effects of turbidity currents.
7 0
3 years ago
Read 2 more answers
A student put some drops of lugols iodine solution into the water in the beaker shown to the right the water turned red after a
alekssr [168]

Answer:

diffusion through a selectively permeable membrane

Explanation:

The cell membrane selectively allows certain substances to enter or leave a cell . This implies that cell membranes are selectively permeable; they allow some substances to pass through, but not others.

Direct transport of materials across the cell membrane is often passive. Passive transport does not require energy to occur. Passive transport is the movement of substances  from a region of higher concentration to a region of lower concentration. A concentration gradient is always required.

The diffusion through a selectively permeable membrane is an example of passive transport.

The iodine moves into the dialysis tube across the semi permeable cell membrane from a region of higher concentration to a region of lower concentration in response to a concentration gradient.

4 0
3 years ago
The number of domains kingdoms and classification levels
Kazeer [188]
There are three domains, and six kingdoms.
8 0
2 years ago
Give the expected product of the acetylation of p hydroxybenzyl alcohol with acetic anhydride
yulyashka [42]
<span>Answer: Assuming there is enough acetic anhydride available, then both OH groups will be acetylated to give their acetate esters (OCOCH3). Use a drop of sulfuric acid as the catalyst.</span>
4 0
3 years ago
Two pure substances combine to make a new substance. The new substance cannot be
jok3333 [9.3K]
Mixture should be the answer.
4 0
3 years ago
Other questions:
  • Each gram of carbohydrate supplies how many calories?
    13·1 answer
  • Assume saccharomyces cerevisiae is grown in a nutrient medium containing the radioisotope 35p. After a 48-hour incubation, the 3
    8·1 answer
  • A high caffeine intake can affect pms symptoms. <br> a. True <br> b. False
    15·2 answers
  • What genetic mutation would cause the most dramatic change in the genetic make-up of an individual?
    13·1 answer
  • When the lymphatic structures of a limb are blocked due to tumors, the result is?
    14·1 answer
  • The innermost meninx that protects the brain and spinal cord is the _________.
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • If F=full pea pods &amp; f=constricted pea pods, what would the offspring of a cross between these parents: FF x ff look like?
    9·1 answer
  • What are examples of things within an athlete’s internal focus?
    6·2 answers
  • Which of the following is not true regarding the establishment of a neuron's resting membrane potential?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!