1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
2 years ago
14

How are loud car noises and loud music similar?

Biology
2 answers:
Vitek1552 [10]2 years ago
7 0

Answer:

it loud and noisy

Explanation:

earnstyle [38]2 years ago
7 0

Answer: They are both similar because when a car makes a noise it can be a beep of the horn or the engine. And music can also make loud noises to but they are alike because a car is able to make noises that can be use for music. and a horn can sound like a trumpet.

Explanation: I hope this helped sorry if it did not. have an amazing day and stay safe

You might be interested in
What molecules need to travel<br> through ATP synthase to help it<br> create ATP?
Anna [14]

Answer

Hydrogen ion movement form ATP in ATP synthase .

Explanation:

ATP synthase is present in mitochondrial membrane when pass hydrogen ion in to lumen of mitochondria and due to proton gradient generate ATP molecule with pass of hydrogen ion into lumen ATP is formed from ADP and inorganic phosphorous molecule . Passing of three hydrogen io generate one ATP molecule .So movement of hydrogen ion is directly related to ATP synthases.

3 0
3 years ago
Cutting out or off, without replacement, a portion of a body part is called ____.
sertanlavr [38]
Excision is the right answer :)
6 0
3 years ago
Where do convection currents occur
Rus_ich [418]

Answer:

C. in areas with different air pressures

Explanation:

"Convection currents occur within:

The geosphere – plate tectonics

The atmosphere - wind

The hydrosphere - ocean currents"

Hope this helps u.

4 0
3 years ago
When do plants use oxygen<br>​
irina1246 [14]

Answer:

When there is no sunlight and they undergo cellular respiration

Explanation:

Plants respire to get energy like animals. In this chemical process, glucose food breaks down in the presence of oxygen to form carbon dioxide and water with the release of energy. See the diagram below

I hope this helps!

8 0
2 years ago
A popular seedless vascular plant is _____.<br> moss<br> the juniper<br> the fern<br> the rose
Readme [11.4K]
Hi lovely,

The answer you're looking for would be the fern !!
4 0
3 years ago
Read 2 more answers
Other questions:
  • Click on "Embankment dam at a gold mine." Of the two opinions to consider in this case, which one presents a stronger argument?
    10·1 answer
  • 1. A source of simple carbohydrates is<br> a. seeds c. fruits<br> b. brownrice d. potatoes
    5·2 answers
  • Explain the process of digestion of food in small intestine of man​
    14·1 answer
  • *PLEASE ANSWER AS SOON AS POSSIBLE. TY* Deforestation is a problem because it decreases biodiversity. Why does this happen? a.)
    15·2 answers
  • Which of the following describes a rapidly expanding population?
    10·2 answers
  • Data mining contributes to the field of
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is the relationship between cytoplasm and the nucleus of a cell?
    13·1 answer
  • Which was Ventor’s contribution to science?
    11·2 answers
  • Differiantiate between photolysis and carbon (IV)oxide fixation​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!