1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frez [133]
2 years ago
13

Hi everyone! I have a very urgent work so please help me as fast as you could! I beg you. Your immediate action would be kindly

appreciated

Mathematics
1 answer:
romanna [79]2 years ago
3 0

Answer:

-3/8

Step-by-step explanation:

PemDas

2/3 x 3/4= 1/2

3/4 x -1/2 = -3/8

full equation is now

1/2 - 1/2 + -3/8

1/2-1/2 =0

-3/8 remains

You might be interested in
Please help me on this one thx i really need this one.
MrRissso [65]

Answer:

6 meters

Step-by-step explanation:

Every 7 floors, it goes up by 22.4 meter intervals.

Let's count down,

the 7th floor would be 50.8 - 22.4, which is 28.4.

the 0th floor would be 28.4 - 22.4, which is 6.

7 0
2 years ago
Read 2 more answers
5. Use the Pythagorean theorem to estimate the length of the unknown side of the right triangle. Explain why
photoshop1234 [79]

Answer:

Step-by-step explanation:

a^2 + b^2 = c^2

6 = b

c= 8

a=?

now u just replace

a^2 + 6^2 = 8^2

a^2 + 32 = 64

a ^2 = 64-32

a^2 = 32

\sqrt a^{2}  = \sqrt32

a     = 5.65685424949

if you rounded

a = 5,7

3 0
2 years ago
Jess is comparing fractions, which fraction is greater than 5/6?<br> A) 7/8B) 4/5C) 3/4D) 2/3
levacccp [35]
I think the answer is D

                                                                    
6 0
3 years ago
Read 2 more answers
Fill in the table using this function rule.<br> y = 10x + 1
aleksandr82 [10.1K]
Y=10x+1
x=-1→y=10(-1)+1=-10+1→y=-9
x=0→y=10(0)+1=0+1→y=1
x=1→y=10(1)+1=10+1→y=11
x=5→y=10(5)+1=50+1→y=51

x       y
-1    -9
0      1
1     11
5     51
8 0
3 years ago
Read 2 more answers
Mike and his dad are retiling his bathroom floor. They have budgeted $200 for the tiles and supplies. The tiles cost $1.85 each
Feliz [49]

Answer:

Equation: $114.90 + $1.85<em>x</em> = 200

Solution: They can buy 46 tiles.

Step-by-step explanation:

First, subtract 114.90 from both sides to get 1.85<em>x</em> = 85.10.

Divide 85.10 by 1.85 to get 46, which is the answer.

7 0
3 years ago
Other questions:
  • Given the following equation of an exponential function determine the decay rate.
    6·1 answer
  • Evaluate -3x3 - 4x <br><br> for x = -1. <br><br> 7<br> -1<br> 1<br><br> PLSSSS HURRRY
    5·1 answer
  • What is the formula to find the interest
    5·2 answers
  • A multiple choice test has 10​ questions, each of which has 4 possible​ answers, only one of which is correct. If​ Judy, who for
    11·1 answer
  • Elijah bought 3 3/4 pounds of groind hamburger meat for $11.00. What is the price per pound of the ground hamburger meat. Roind
    6·2 answers
  • Help help help helpn
    11·1 answer
  • A painter earns $15 per hour. What is the minimum number of hours he must work to earn at least $200? write an inequality to rep
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Convert (10111)2 into decimal number system​
    8·1 answer
  • AXYZ is reflected across the y-axis. What are the endpoints of segment YZ?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!