1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
15

Drag the tiles to the correct boxes to complete the pairs.

Biology
1 answer:
Elodia [21]3 years ago
5 0

Answer:

1. prey-preditor

2. parasitism

3. commensalism

Explanation:

/

You might be interested in
List two important groups of organisms that appeared during each of the three most recent geologic eras
Afina-wow [57]
I think it is particoul and artrical lol hopefully this helps 

3 0
3 years ago
Read 2 more answers
True or False: Good graphs should have a descriptive title that includes both variables.
Anna007 [38]
The answer is true they should have both
8 0
2 years ago
Which of these is NOT a type of fungi?<br><br> yeast<br><br> mold<br><br> algae<br><br> mushrooms
Angelina_Jolie [31]

Answer: Algae

Explanation:

Algae

Algae are grouped in the kingdom Plantae. The unicellular blue-green algae are kept under the kingdom Protista

Fungi

In the five-kingdom classification by Whittaker, fungi were placed in a separate kingdom Fungi

7 0
3 years ago
What is the primary information that a map shows ?
IceJOKER [234]
Where something is located

5 0
3 years ago
Which of the following represents a duplication in the DNA sequence A-G-T-C-T?
dimulka [17.4K]

Answer:

wym i canr see the examples

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • What role does cellular respiration play in the water cycle
    13·2 answers
  • Which of the following enables a cell to pick up and concentrate a specific kind of molecule?
    13·1 answer
  • Construct incomplete dominance vs codominance
    9·1 answer
  • 9. If a farmer stops using his farmland for crops, and no other humans come to grow their crops
    8·1 answer
  • 2. Match the following:
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which type of physical weathering causes intrusive igneous rocks to break into massive sheets like an onion?
    5·1 answer
  • HELP WILL GIVE BRANLIEST!Can all animals regenerate? Explain.
    5·1 answer
  • 68 paramecia are found in an area measuring 2 cm x 3 cm. _____ paramecia/cm2 *
    8·1 answer
  • Calculate the ratio of H+ ions to OH– ions at a pH = 7. Find the concentration of H+ ions to OH– ions listed in Table B of your
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!