1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
3 years ago
9

A nonrenewable resource that developed from the remains of ancient plants that lived in large swamps millions of years ago is:

Biology
1 answer:
uysha [10]3 years ago
6 0

Answer:

★ A nonrenewable resource that developed from the remains of ancient plants that lived in large swamps millions of years ago is COAL

Explanation:

Hope you have a great day :)

You might be interested in
Klineflter syndrome is a defect occurs during
expeople1 [14]

Explanation:

The 47,XXY karyotype of Klinefelter syndrome spontaneously arises when paired X chromosomes fail to separate (nondisjunction in stage I or II of meiosis, during oogenesis or spermatogenesis

7 0
3 years ago
Wich of the following can combine in a cell to convert a lower-energy molecule into a higher-energy molecule
valentinak56 [21]

Answer:

You're answer is D, ATP+P

Explanation:

7 0
3 years ago
What two skills or abilities are important for him to have to be successful quality control inspector
Artemon [7]

The two skills are understanding blueprints an technical documents and using specialized tools to test products.

8 0
3 years ago
Over time, data that support the successful
omeli [17]
The answer is (3) an increase in the proportion of offspring <span>that have favorable characteristics.

</span>In natural selection, genotype variations that will increase the chance of survival and reproduction of some organism are preserved and will be inherited. Peppered moth color variation is a good example of natural selection.<span>During the Industrial revolution, due to pollution, trees become darker in the urban area. Light-colored moths were, thus, easy prey. The dark-colored moths were able to camouflage on dark trees and avoid predators. The phenomenon is known as industrial melanism. So, in polluted urban areas, the number of dark-colored peppered moths increased. In the clean environment, were much effective in hiding from predators and they outnumbered the dark-colored moths.
Therefore, the </span>proportion of offspring <span>that have favorable characteristics in such environment will increase.</span>

6 0
3 years ago
Sustainability of land use is involved in three parts. Which areas are these?
yarga [219]

1) full-cost pricing, (2) win-win solutions, and (3) a responsibility to future generations.

7 0
3 years ago
Read 2 more answers
Other questions:
  • In ancient times, scientists believed that matter could be destroyed by burning or breaking. Modern scientists believe that matt
    14·2 answers
  • Are hydrogen bonds an example of adhesion or cohesion?
    10·1 answer
  • Which of these would increase the carrying capacity of a prairie dog habitat?
    14·1 answer
  • What are the characteristics of high energy waves?
    12·2 answers
  • Explain the relationship between insulin and glucagon?
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which one of the following substances is not excreted by the human body?
    7·2 answers
  • ¿Que pasa cuando ingerimos algunas sustancias adictivas? A: Afectan nuestro sistema circulatorio B: Afectan nuestro sistema resp
    7·1 answer
  • Draw a line to connect the following terms to their definitions. PLZ HURRY!
    15·1 answer
  • Which of the following
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!