Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Purple colour arises due to the dominant alleles whereas white colour arises due to the recessive alleles.
For the purple colour to arise, even one of the dominant allele will be enough to cause the effect. On the other hand to see the recessive white trait, both the alleles of the gene should be recessive.
To ensure that only white flowers are grown, the farmers need to cross both white flowered plants to get the desired result.
Answer: (c) seed type
Explanation:
An independent variable is the one which can be altered or manually manipulated in an experiment. The effect of such manipulation can be examined on the dependent variable of the experiment. The dependent variable cannot be manipulated in an experiment instead it is the outcome of the experiment.
The seed type is the correct answer because the seed type can vary and the effect of which can be examined on the seed germination process and rate of seed germination.
Vitamin A deficiency is the leading cause of preventable blindness in children.
I would say A. Mainly because the teacher is well trained for situation where it's critical or something like that..
