The process is photosynthesis
An example of a complex trait is
weight.
Complex trait or quantitative trait is a trait that doesn’t behave according to simple Mendelian inheritance laws. These traits show a continuous range of variation and are influenced by both environmental and genetic factors. It is often said that complex traits<span> are those that are influenced by more than one factor.</span>
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
No ATP is available to release attached actin and myosin molecules.
Explanation:
Two to six hours later after death, all skeletal muscles of the body become rigid and stiff. This situation is defined as Rigor mortis. It occurs from the lack of ATP along with the production of lactic acid. When breathing stopped permanently in the body, oxygen level also reduced; that’s why body muscles cannot go for any aerobic respiration to produce any ATP.
As we know already, during every muscle construction, ATP needs to break the cross-bridge between Myosin and Actin. So if there is no ATP produced in the body, separation of Myosin molecules from Actin molecules cannot happen anymore. This situation leads for rigor mortis.
