1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
2 years ago
11

2Fe(OH)3 Fe2O3+3H2O how many grams of Fe2O3 are produced if 10.7 grams of Fe (OH)3 react in this way

Chemistry
1 answer:
sasho [114]2 years ago
3 0

Answer: 7.98 grams of Fe_2O_3 are produced if 10.7 grams of Fe(OH)_3 are reacted.

Explanation:

To calculate the number of moles, we use the equation:

\text{Number of moles}=\frac{\text{Given mass}}{\text{Molar mass}}      .....(1)  

Putting values in equation 1, we get:

\text{Moles of} Fe(OH)_3=\frac{10.7g}{106.87g/mol}=0.100mol  

The chemical equation for the reaction is

2Fe(OH)_3\rightarrow Fe_2O_3+3H_2O

By Stoichiometry of the reaction:

2 moles of Fe(OH)_3 produce = 1 mole of Fe_2O_3

So, 0.100 moles of Fe(OH)_3 produce= \frac{1}{2}\times 0.100=0.05mol of Fe_2O_3  

Mass of Fe_2O_3 =moles\times {\text{Molar Mass}}=0.05mol\times 159.69g/mol=7.98g  

Hence 7.98 grams of Fe_2O_3 are produced if 10.7 grams of Fe(OH)_3 are reacted.

You might be interested in
Diseases can spread rapidly in cities. If a disease kills many people in a city but fewer in a rural area, this is an example of
Inga [223]

Answer:

Density independent factor

Explanation:

in dense areas where people livein  very close and tight spaces

5 0
3 years ago
The voltage generated by the zinc concentration cell described by the line notation Zn ( s ) ∣ ∣ Zn 2 + ( aq , 0.100 M ) ∥ ∥ Zn
Oxana [17]

Answer:

0.193 M

Explanation:

We need to calculate the Zn²⁺ concentration at the cathode where reduction occurs which is the right side in the expression:

Zn2+(aq,0.100 M) ‖ Zn2+(aq,? M) | Zn(s)

Zn²⁺ (aq,?) + 2 e⁻   ⇒ Zn (s)

and oxidation will occur in the anode

Zn (s) ⇒ Zn²⁺ (aq, 0.100 M ) + 2 e⁻

and the overall reaction is

Zn²⁺ (aq,?) ⇒ Zn²⁺ (0.100 M )

The driving force is the difference in concentration and E the electromotive force will be given by

E = Eº - 0.0592/2 log [Zn²⁺ (0.100 M) / Zn²⁺ (M) ]

Plugging the value for E and knowing Eº is cero because we have the same electrodes, we have

17.0 x 10⁻³ = 0 - 0.0592 log 0.100/ X =

- 17.0 x 10⁻³ / 0.0592 = log 0.100 / X

- 0.287 = log (0.100 / X)

Taking inverse log to both sides of the equation

0.516 = 0.100 / X   ⇒ X = 0.100 / 0.516 = 0.193 M

4 0
3 years ago
What is the resistance of a 150 W lightbulb connected to a 24 V voltage source?
Luda [366]

Answer:

3.84 Ω

Explanation:

From the question given above, the following data were obtained:

Electrical power (P) = 150 W

Voltage (V) = 24 V

Resistance (R) =?

P = IV

Recall:

V = IR

Divide both side by R

I = V/R

P = V/R × V

P = V² / R

Where:

P => Electrical power

V => Voltage

I => Current

R => Resistance

With the above formula (i.e P = V²/R), we can calculate resistance as illustrated below:

Electrical power (P) = 150 W

Voltage (V) = 24 V

Resistance (R) =?

P = V²/R

150 = 24² / R

150 = 576 / R

Cross multiply

150 × R = 576

Divide both side by 150

R = 576 / 150

R = 3.84 Ω

Thus, the resistance is 3.84 Ω

4 0
3 years ago
How does the electron configuration of elements within the same group compare? (A.) They all have their valence electrons in the
lesya [120]

Answer:

B.They all have their valence electrons in the same type of subshell

Explanation:

  • The electron configurations of elements in the same group (column) of the periodic table have them in the same type of subshell.
  • But the subshells may be of different shells. Thus , the energies of them need not be the same.
  • For example , The Alkalai Metals are found in the first column of the periodic table Group IA. This set of elements all have valence electrons in only the 's' orbital and because they are in the first column they all have s^{1} configuration. i.e,
  1. H 1s^1
  2. Li 1s^2 2s^1
  3. Na 1s^2 2s^2 2p^6 3s^1
  4. K 1s^2 2s^2 2p^6 3s^2 3p^64s^1
5 0
3 years ago
The first step in using time more efficiently is
REY [17]
The answer is studying how people use time.

Hope this helps!
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the sea of instability
    12·2 answers
  • At high pressures, real gases do not behave ideally. calculate the pressure exerted by 18.0 g h2 at 20.0°c in a 1.00 l container
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is the name of MnO3
    6·2 answers
  • A. On the Periodic Table of Elements, columns are called ______________________; all of these
    8·2 answers
  • What is the 250 green numbers on the side
    8·1 answer
  • During an experiment, 104 grams of calcium carbonate reacted with an excess amount of hydrochloric acid. If the percent yield of
    11·1 answer
  • PLEASE PLEASE HELP ME!! I WILL BRAINLIST YOU!! A 28.0 g sample of N2 is in a rigid 4.50 L container at 32 °C. Calculate the pres
    7·1 answer
  • ____________Polar regions get less of the sun's direct rays, they are the coldest climates on Earth. A because , B although, C H
    5·1 answer
  • 2CO(g) + O2(g) = 2CO2(g)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!