1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Greeley [361]
3 years ago
9

In your own words, who were the alchemists? What do you know about them and their work so far?

Biology
2 answers:
andrey2020 [161]3 years ago
8 0
Alchemy is an ancient practice shrouded in mystery and secrecy. Its practitioners mainly sought to turn lead into gold, a quest that has captured the imaginations of people for thousands of years. However, the goals of alchemy went far beyond simply creating some golden nuggets.

Alchemy was rooted in a complex spiritual worldview in which everything around us contains a sort of universal spirit, and metals were believed not only to be alive but also to grow inside the Earth. When a base, or common, metal such as lead was found, it was thought to simply be a spiritually and physically immature form of higher metals such as gold. To the alchemists, metals were not the unique substances that populate the Periodic Table, but instead the same thing in different stages of development or refinement on their way to spiritual perfection.

As James Randi notes in his "Encyclopedia of Claims, Frauds, and Hoaxes of the Occult and Supernatural," "Beginning about the year 100 and reaching its flower in medieval times, alchemy was an art based partly upon experimentation and partly upon magic. Early investigators of natural processes centered their search on a mythical substance they knew as philosopher's stone, which was supposed to possess many valuable attributes such as the power to heal, to prolong life, and to change base metals into precious metal — such as gold." (This "philosopher's stone" was not a literal stone but instead a wax, liquid, or powder that held magical powers.)

alina1380 [7]3 years ago
5 0

Answer:

an alchemist is a person versed in the art of alchemy their goal was to create philosophers stone and discovery of elixir of life

Explanation:

hope it helps❤️

You might be interested in
The vaccine sends in a weakened or _______ Immune System mount the defense
Anna007 [38]

Answer:

fighting immune system

Explanation:

8 0
4 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Scientists can find new discoveries that change their current understanding of scientific knowledge.
Dahasolnce [82]
I would say true. I say this because there have been times where scientists find out that there are better ways of performing experiments, or found that certain materials work better for certain tasks. (Especially true in medicinal fields!)
6 0
3 years ago
Read 2 more answers
Considering the experimental design, which claim is best supported using the data?
VLD [36.1K]

Answer:

C low competition for glucose

Explanation:

From the given answer choices and information,

It cannot be A since there is no visual disease or any indication of disease in the experiment

Cannot be B, since space would not be an issue since it clearly hit 111 on day 3

and cannot be D since there is no indication of a change in temperature.

However, we know Petri Dishes have nutrients to stimulate cell growth, and those resources are not unlimited therefore we can only attest that a large portion of the nutrients have been consumed and starved some of the cells thus causing a population decrease

3 0
3 years ago
Modern corals are restricted to growing in warm, clear, well-lit, shallow water. Over the last two million years, coral reefs ha
vova2212 [387]

The answer is Climate change. It will take decades for the coral reef to recover from the catastrophic climatic changes including El Nino in 1997-98. Climate Change is the main and undeniable threats to the loss of the corals. It has negative effects on coral populations in some ways. This includes the Color Bleaching, Coral Disease, and Ocean Acidification. 

5 0
3 years ago
Read 2 more answers
Other questions:
  • Can you get heart problems from eating too much reddit
    13·1 answer
  • Which best describes red blood cells?
    5·1 answer
  • Cats and rainbows and J-Biebs! Oh, my! What's the most viewed video on YouTube?
    6·2 answers
  • When you wrinkle your eyebrows together as you concentrate on your quiz in class, the muscle that is pulling the eyebrows togeth
    11·2 answers
  • How would an animal breeder breeder breed cows that gives more milk
    5·2 answers
  • What's the answer to number 17 and 18?
    11·1 answer
  • Write a complementary dna bases of the following dna strand: CAAGGTACTAG
    7·1 answer
  • If you were a scientist studying traits which are selected by humans instead of the environment, you would be studying the follo
    7·1 answer
  • How does a desert,savanna and grassland help a environment!!​
    7·1 answer
  • What is the main disadvantage of overdraft protection?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!