1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
8

EL hidroxido de sodio reacciona con el sulfato de hierro (II) para formar sulfato de sdio e hidroxido ferroso. Si se hace reacci

onar 250g de hidroxido de sodio ¿Cuantos g de hidróxido ferroso se produce?
Chemistry
1 answer:
Oduvanchick [21]3 years ago
7 0

Answer:

280.8 g

Explanation:

Definimos la reaccion:

2NaOH +  FeSO₄  →  Na₂SO₄  +  Fe(OH)₂

Como tenemos la masa de NaOH, asumimos que el sulfato de hierro (II) es el reactivo en exceso.

Definimos masa de reactivo: 250 g . 1mol / 40g = 6.25 mol

2 moles de NaOH producen 1 mol de hidroxido ferroso

Entonces 6.25 moles producirán, la mitad (6.25  . 1) /2 = 3.125 moles

Convertimos los moles a masa:

3.125 mol . 89.85 g/mol = 280.8 g

You might be interested in
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Where are lighter elements fused into elements more massive than iron?
Kaylis [27]
The answer is a supernova. 
4 0
3 years ago
What is measured by the reaction rate?
Andreyy89
The reaction rate is the speed at which products form, based on the rate of the slowest step in the mechanism.
6 0
3 years ago
Read 2 more answers
Cole is working with radioactive particles and has set up a shield made of aluminum for protection. Which of the following will
koban [17]

Answer:

C.) Alpha, beta, and gamma particles

Explanation:

A dense shield of aluminium can protect Cole from all the listed types of radiation produced from the radioactive particles.

A radioactive protector has very unique and specie ability to contain and prevent the movement of radiations of any types from going into the body.

The strongest and most penetrating radiations are the gamma rays. Any material that can prevent the movement of these rays can halt alpha and beta particles too.

An aluminium shield is made up of multiple layers of aluminium stacked together and it provides enough resistance.

6 0
3 years ago
Read 2 more answers
What are the complete Ionic and Net Ionic equations for the following
zhenek [66]

Answer:

Check photo

Explanation:

5 0
3 years ago
Other questions:
  • What makes metalloids a group of their own?
    12·2 answers
  • Describe how a mole ratio is correctly expressed when it is used to solve a stoichiometry problem
    7·1 answer
  • 1) How many different charges can O or H atoms have?
    13·1 answer
  • How do you do today!?​
    7·2 answers
  • Water (10 kg/s) at 1 bar pressure and 50 C is pumped isothermally to 10 bar. What is the pump work? (Use the steam tables.) -7.3
    10·1 answer
  • The different parts of a Test Tube.
    9·1 answer
  • 354.5 g of chlorine gas (MW = 70.9 g/mol) is held in a vessel with a fixed volume of 70. L.
    15·1 answer
  • Stirring increases the rate of dissolution because it?
    5·1 answer
  • A smaller gear driving a larger gear gives a blank advantage (called blank gears) 
    13·1 answer
  • How many electrons are lost or gained in forming each ion? a. Ba2+ b. As3- c. Cu2+
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!