1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
6

Anyone know any good books to study exam style questions for 9th grade biology?

Biology
1 answer:
krek1111 [17]3 years ago
5 0

Answer:

I'm not too sure specifically for 9th grade. Though I am in 12th grade right now and currently using the Edrolo biology textbook which is solely based on the key dot points/skills for the entire subject. They also include past exam questions or similar exam style questions both multiple choice and short answer for each topic and chapter within the book.

Explanation:

You might be interested in
99 POINTS Please help?!?! How can a chromosone regulate transcription and increase it?
mezya [45]
C the region that codes for rna folds 


i don't know if this is right i tried 
5 0
3 years ago
Read 2 more answers
The tendency to respond to a stimulus that is similar to the original conditioned stimulus is called _____________.
german
Stimulus generalization
5 0
3 years ago
WHO CAN HELP 20 pys⭕️
zubka84 [21]
The mother has a 50% chance of having a child with that condition. Hope my work helps!
4 0
3 years ago
A delta at the mouth of a river is the direct result of
Simora [160]
A river delta 
Hope it helped!
8 0
3 years ago
Opossums are solitary animals that usually meet in nature only to mate. What is their probable distribution pattern?
Goryan [66]

Random distribution is the probable distribution pattern of opossums.

Explanation:

The opossums are the member of low density population. They are sparsely distributed because of the low number. There are troubles for them to find a mate.

Their habitat makes them solitary as they have flexible dietary habits. they are terrestrial animals living in burrows and are nocturnal.

They have random distribution pattern. The opossums are distributed in the population as random. The mates in opossums do not have choices of mates and the environment conditions in which they live are stagnant.(having no social life). Random interaction is seen in <em>species which do not have any social  bonding</em> between the species of the animals or plants.

7 0
3 years ago
Other questions:
  • How does polymerase chain reaction make DNA fingerprinting more reliable
    7·2 answers
  • 4. Summarize how a single change at the cellular level can impact the<br> entire body
    12·1 answer
  • How do you test for sugar
    5·1 answer
  • What are the two supporting evidence of seafloor spreading theory?
    9·1 answer
  • What is a common theme found amoung nonrewnable resources ?
    5·1 answer
  • What do living things need to live and grow?
    13·1 answer
  • How is  eukaryotic RNA processed before leaving the nucleus 
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 10.) What hormone is released due to the rising level of estrogen in the bloodstream?​
    11·2 answers
  • An unidentified organism that makes its own food and whose cells have a cell wall and a nucleus would be a member of which domai
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!