All categories

3 years ago

What can crystalize size tell us about where an igneous rock formed?

Biology

1 answer:

sergejj [24]3 years ago

4 0

Explanation:

The size of crystals in igneous rocks can tell us about the physical environment under which the rock formed.

Igneous rocks are rocks that are derived from molten magma formed within the crust.

When large crystals are formed, it suggests that the magma has cooled slowly without any disturbance. Slow cooling of magma makes minerals to surround nucleation centers easily an take their time to form.
When small crystals are formed, we can infer that cooling was rapid. Magma had to cool rapidly and several nucleation centers resulted.
Large crystals in rocks are usually produced deep beneath the earth crust forming a rock type known as plutonic igneous rocks.
Those with small crystals that forms on the surface are called extrusive or volcanic igneous rocks.

Learn more:

Igneous rocks brainly.com/question/2740663

#learnwithBrainly

You might be interested in

Which of the following is not an example of a negative feedback loop?<br>

kumpel [21]

Answer:

Birth is an example of a normally occurring positive-feedback mechanism.

4 0

3 years ago

Read 2 more answers

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

Determine whether each phrase describes ponds or lakes.

VikaD [51]

Answer:

Ponds:

Shallow & warm

A lot of plant and animal life

Many nutrients

Lakes:

Large, deep, cold

Little sunlight near bottom

Plants mainly along the shore

6 0

3 years ago

Read 2 more answers

) Consider a pea plant- it has a gene controlling seed color- yellow Vs green; another gene controlling seed texture-smooth Vs w

lana [24]

Answer:

Yellow smooth - 9

Yellow wrinkle - 3

Green smooth- 3

Green Wrinkle - 1

Explanation:

Let the green color of the seed be depicted by "G" and the yellow color of the seed be depicted by "g"

Let the smooth the seed be depicted by "R" and wrinkled seed be depicted by "r"

F1 cross -

true breeding smooth green plant ( RRGG) and true breeding wrinkled yellow (rrgg)

F1 gamete will be RG, RG, rg, rg

F1 offspring will be RrGg , Thus all F1 offspring will be heterozygous smooth and yellow.

Thus, R is dominant over r and g is dominant over G

F2 Generation –

RrGg x RrGg

Gametes will be RG, Rg, rG, rg

RG Rg rG rg

RG RRGG RRGg RrGG RrGg

Rg RRGg RRgg RrGg Rrgg

rG RrGG RrGg rrGG rrGg

rg RrGg Rrgg rrGg rrgg

R is dominant over r and g is dominant over G

Genotypes are –

RRGG - 1 (Smooth Green)

RRGg-2 (Smooth yellow)

RrGG-2 (Smooth Green)

RrGg-4 (Smooth yellow)

RRgg- 1 (smooth yellow)

Rrgg – 2 (Smooth yellow)

rrGG – 1 (wrinkled Green)

rrGg – 2 (Wrinkled yellow)

rrgg – 1 (wrinkled yellow)

Yellow smooth - 9

Yellow wrinkle - 3

Green smooth- 3

Green Wrinkle - 1

4 0

3 years ago

Sedaia [141]

Differences and similarities between igneous , metamorphic , and sedimentary rocks . sedimentary rocks are formed by weathered sediment using cementation or precipitation on Earth's surface . Metamorphic rocks are formed by changes of pressure and temperature within Earth's surface .

3 0

3 years ago

Read 2 more answers