1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kari74 [83]
3 years ago
14

Animals in the taiga and alpine biomes hibernate during winter.

Biology
2 answers:
siniylev [52]3 years ago
6 0

Answer:

True on edge just did it

Explanation:

nydimaria [60]3 years ago
5 0

Answer:

True. They do hibernate during the winter, right on EDGE2020

Explanation:

You might be interested in
What do grey pentagons represent?
Naily [24]

Answer:

The Pentagon is the headquarters building of the United States Department of Defense. As a symbol of the U.S. military, the phrase The Pentagon is also often used as a metonym for the Department of Defense and its leadership.

Explanation:

3 0
4 years ago
In this exercise, you extracted DNA from your cheek cells. If you could magnify the extracted material, how many individual chro
Llana [10]

Answer:

46 chromosomes

Explanation:

Humans are diploid organisms i.e. they contain two sets of chromosomes (each set from each parent). Each set is 23 chromosomes, hence, two sets will be 23 pairs or 46 chromosomes. This means that each somatic/body cell will contain 46 individual chromosomes.

According to this question, DNA was extracted from a cheek cell. If one could magnify the extracted material, there would be 46 individual chromosomes from each of these cheek cells, considering that cheek cell is a somatic cell.

3 0
3 years ago
What happens before mitosis occurs?
Anit [1.1K]
I believe the answer is D. the genetic material of the parent cell multiplies into two sets
3 0
4 years ago
Read 2 more answers
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
When you are observing motion, one object is moving and one object stays in place. The object that doesn't move is called a refe
emmasim [6.3K]
Synonyms for reference point:
View, viewpoint, or maybe even perspective.
7 0
3 years ago
Other questions:
  • "On the Mode of Communication of Cholera" was a scientific text written by Dr. John Snow in 1855 about the disease cholera. Iden
    8·2 answers
  • Select all that apply. The first step of cellular respiration involves _____.
    11·2 answers
  • How do organisms interact with other living things
    13·2 answers
  • The magnetic particles in seafloor ridges are aligned differently in a repeating pattern. How
    9·1 answer
  • Name the scientists who proposed the cell theory
    7·2 answers
  • Larger animals have?
    14·1 answer
  • 4. Distinguish between the types of scientific
    5·1 answer
  • Can someone help me please
    5·2 answers
  • Que es la biodiversidad?
    6·1 answer
  • Which of these do plants not obtain using active transport
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!