1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adell [148]
3 years ago
11

Which step in the process of cellular respiration produces the most ATP?

Biology
1 answer:
cluponka [151]3 years ago
4 0

Answer:

c. electron transport chain and oxidative phosphorylation

Explanation:

You might be interested in
What are the abiotic and biotic factors of oil?
TiliK225 [7]

Answer:

abiotic-water

biotic-ocean currents

7 0
2 years ago
The majority of time during a cells life is spent in _____
stealth61 [152]
Your answer is A interphase.

5 0
3 years ago
Read 2 more answers
The large flat muscle that moves up and down and alters the volume of the chest cavity is the
Shkiper50 [21]
Diaphragm...is the muscle that helps in respiration.....there are also some other but....you said flat so diaphragm !
4 0
3 years ago
How do the prefixes endo- and exo- help you remember the definitions of the terms endocrine and exocrine?
Tasya [4]

Answer: it shortened the name and easier to remember

Explanation:

8 0
3 years ago
Read 2 more answers
What is the impact of developing and using rock, mineral, and energy resources on earth's living and non living systems
77julia77 [94]

Answer:  The use of rock, mining and energy production contaminates the environment by affecting the abiotic land mass. And therefore, by contaminating the habitat, the living beings that live there are harmed.

Explanation:

<u>Mineral and rock extraction, transport and processing comprise actions that produce environmental impacts because it produces a certain disturbance to the surface and underlying strata, as well as to aquifers</u>. These impacts can be short-lived, lasting as long as the mine is operational, or they can persist after mine development has been completed.

Major impacts include:

  • Contamination of soil, vegetation, drainages, rivers and groundwater aquifers contamination from leaking tailing piles and slurry ponds. If not properly treated, effluent from surface or subway mine water disposal can be highly acidic, and will contaminate surface waters and shallow groundwater with heavy metals, nitrates or oil from equipment, reducing local water supplies. During surface mining, movement and stockpiling of overburden, constructions or covering of soils alter rivers, drainages and coastal areas.
  • Surface disturbance caused by access roads, pits, and site preparation.
  • Noise and emissions from the operation of equipment.
  • Air pollution, atmospheric dust from traffic, excavation, drilling and site clearing. Atmospheric particulates come from blasting, excavation and earth moving, transportation or any operations that occur on the surface of subway mines.
  • Removal of rock strata can disrupt the continuity of the local aquifer, and cause interconnections and contamination between groundwater.

<u>Both surface and subway mining include a drainage of the mine area and discharge of mine water, the removal and storage/disposal of large volumes of waste and the transfer and processing of minerals or construction materials.</u> This requires the use of diesel or electric mining and haulage equipment. Transportation of ore within the mine area and to processing facilities may use trucks, conveyors, rail, polyduct or conveyor belt which are vehicles that emit large amounts of carbon dioxide.

Processing plants may be located in mountainous regions and so may have difficulty disposing of production wastes and other pollutants. <u>They may then end up disposing of them in rivers or coastal waters.</u>

The land at the surface of the mines will be unstable, there will be fracturing and subsidence, it will modificate soils, vegetation, rivers, wildlife habitat, wetlands, causing a temporary or permanent loss of land productivity, and <u>contamination of soils due to mineral materials and toxic substances</u>.

<u>Also, the production and use of energy is the main cause, together with transportation, of greenhouse gas emissions, the gases responsible for climate change</u>. Consequences of climate change are increased temperatures, rising sea levels and reduced rainfall.

The current model of generation, transport and consumption, <u>absolutely dependent on fossil fuels, is unsustainable</u>. The chemical products emitted, mainly from coal and oil-derived thermal power plants, are transported by the wind and deposited by rainfall thousands of kilometers away from their origin, causing "acid rain", which is <u>the cause of the deterioration and destruction of forests, lakes and other ecosystems</u>. Another example are the N<u>uclear power plants which produce high-level radioactive wast</u>e (long-lived, highly radioactive), which poses a constant threat to the environment due to the current inability to manage it.

Thus, the use of rock, mining and energy production contaminates the environment by affecting the abiotic land mass. And therefore, by contaminating the habitat, the living beings that live there are harmed.

6 0
2 years ago
Other questions:
  • Upon entering a patient's room to complete discharge instructions, the nurse discovers the patient in tears. the business office
    12·1 answer
  • Lorek lives near the North Pole. The snow in his backyard adds water to the atmosphere through ____. )transpiration )evaporation
    15·1 answer
  • Explain the significance of the high heat capacity of water.
    7·1 answer
  • A student observes 5,000 RFUs in a 200μl aliquot from a G3-500 ml culture. How many total RFUs will be present in a G3-15ml samp
    11·1 answer
  • Cathy hypothesized that corn would not grow in mud. To test this hypothesis, she took corn kernels and placed 5 in mud, 3 in soi
    11·1 answer
  • Why does the body switch between cellular and anaerobic respiration?
    15·1 answer
  • Which best describes why it is important for a scientist to use the metric system when recording data?
    8·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the function of valves between the heart chambers?
    9·1 answer
  • True or false: Torn cartilage heals slowly because it lacks a direct blood supply and nutrients have to be obtained by diffusion
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!