1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
givi [52]
3 years ago
8

C2H6(g) + O2(g) → CO2(g) + H2O(g)

Chemistry
2 answers:
Sindrei [870]3 years ago
6 0
2C2H6+7O2 - ->4CO2+6H20
attashe74 [19]3 years ago
5 0

Answer:

2C2H6 + 7O2 --> 4CO2 + 6H20

Explanation:

Balanced equation

You might be interested in
Name some acids and in what and how we used them
Ne4ueva [31]

Answer:

Acid Uses

Organic acids

Citric acid As a preservative for food As a flavouring agent

Ascorbic acid (also called vitamin C) In the treatment of bone marrow and scurvy diseases

Acetic acid Added to pickles to make them sour

Explanation:

7 0
3 years ago
A gas occupies 2.0 m3 at 100.0k and exerts a pressure of 100.0kPa. What volume will the gas occupy if the temperature is increas
Svetradugi [14.3K]
According to ideal gas equation, we know for 1 mole of gas: PV=RT
where P = pressure,  T = temperature, R = gas constant, V= volume
If '1' and '2' indicates initial and final experimental conditions, we have
\frac{P1V1}{P2V2} =  \frac{T1}{T2}

Given that: V1 = 100.0 kPa, T1 = 100.0 K, V1 = 2.0 m3, T2 = 400 K, P2 = 200.0 kPa

∴ on rearranging above eq., we get V2 = \frac{P1V1T2}{T1} =  \frac{100 X 2 X 400}{200X100}
∴ V2 = 4 m3 
7 0
3 years ago
What is the name given to the ions of the halogens on the periodic table?
WARRIOR [948]

Answer:

halides

Explanation:

This is one electron away from having a full octet of eight electrons, so these elements tend to form anions having -1 charges, known as halides: fluoride, F-; chloride, Cl-, bromide, Br-, and iodide, I-. In combination with other nonmetals, the halogens form compounds through covalent bonding.

7 0
3 years ago
how much current would be measured in a circuit if the light bulb has a resistance of 6 ohms and a voltage of 36 volts
Stels [109]

Answer:

The right response is "6 A". A further explanation is given below.

Explanation:

The given values are:

Resistance,

R = 6 ohms

Voltage,

V = 36 volts

As we know,

⇒  V=IR

then,

⇒  I=\frac{V}{R}

On substituting the values, we get

⇒     =\frac{36}{6}

⇒     =6 \ A

8 0
3 years ago
Which of the following describes an exothermic reaction?
Semmy [17]

Answer:

the answer is option D

Explanation:

exothermic reaction takes place when the energy required to break the bonds in the reactants is less than the energy released when new bonds are formed in the products.

7 0
3 years ago
Other questions:
  • Ben and Jerry were testing powders in science lab. First they put the powder in a zip lock bag. Next they added some water. The
    11·2 answers
  • Vitreous humor is located wear?​
    14·1 answer
  • If there is a graduated cylinder containing 20mL of water and a small rock is gently placed inside it, and the water level insid
    10·2 answers
  • The reaction between nitrogen dioxide and carbon monoxide is NO2(g)+CO(g)→NO(g)+CO2(g)NO2(g)+CO(g)→NO(g)+CO2(g) The rate constan
    10·1 answer
  • Classify each of the following as energy primarily transferred as HEAT or energy primarily transferred as WORK.
    7·1 answer
  • The following chemical reaction occurs in a basic solution.
    6·1 answer
  • What states of matter were present when pure water reached its boiling point
    11·1 answer
  • An example of basic research is A) the development of new plastics that can be recycled. B) the study of the relationship betwee
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Tendency of some minerals to break along a smooth flat surface
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!