1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pogonyaev
3 years ago
14

Hello, how are you doing today?...I am super bored!.

Biology
1 answer:
docker41 [41]3 years ago
6 0

Answer:

Same but almost done with class still gotta do homework tho

Explanation:

You might be interested in
What does atp energy stand for
serg [7]

The Adenosine triphosphate (ATP) molecule is the nucleotide known in biochemistry as the "molecular currency" of intracellular energy transfer; that is, ATP is able to store and transport chemical energy within cells.

8 0
4 years ago
Read 2 more answers
what Mendel's laws or principles explains that traits are passed from parents to offspring individually instead of as pairs, gro
Len [333]
The law of segregation is one of Mendel's laws that explains that traits <span>passed from parents to offspring individually instead of as pairs, groups, or sets. </span>
8 0
3 years ago
The __________ and __________ are the glands that stimulate reproductive cycles.
Jobisdone [24]
The terms that complete the sentence 'The __________ and __________ are the glands that stimulate reproductive cycles' are b. testes . . . ovaries. Testes are male gonads and ovaries are female gonads in animals. These organs are glands that are involved in reproductive cycles. They produce gametes which take place in reproduction, but they also produce hormones that stimulate reproductive cycles. <span>
</span>
8 0
3 years ago
Read 2 more answers
Which statement is a logical inference based on details in the passage? Imported marmalade was available year-round. Imported ma
Arisa [49]

Answer:

Imported marmalade was expensive.

Explanation:

5 0
3 years ago
A process in the star’s core where hydrogen combines to form helium and produces the energy that allows a star to shine is calle
kumpel [21]

Answer:

Nuclear Fusion

Explanation:

A process in the star’s core where hydrogen combines to form helium and produces the energy that allows a star to shine is called nuclear fusion.

I hope it helps! Have a fantastic day!

Bored~

8 0
2 years ago
Other questions:
  • When fertilized what does the ovary grow into
    14·1 answer
  • Predict what would happen if we had no system of lymphatic vessels, and tissue fluid was moved directly back into the circulator
    5·1 answer
  • Genetic engineering has already been used to increase plant production. True False
    7·1 answer
  • Are centrioles always there? or do they only exist during mitosis
    14·1 answer
  • Gorter and Grendel's classic conclusion that the plasma membrane of the human erythrocyte consists of a lipid bilayer was based
    8·1 answer
  • There are three steps in recycling. which is the first step?
    15·2 answers
  • Which of these describes the level of organization of the digestive system?
    9·1 answer
  • Where do animals get carbon from during the carbon cycle
    12·2 answers
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • Please label !! thank you :)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!