Answer:
a.Many mitochondrial genes resemble proteobacteria genes, while the genes in the chloroplast resemble genes found in some photosynthetic bacteria.
c.Mitochondria and chloroplasts both have their own circular DNA and 70S ribosomes that are similar to those found in bacteria.
d.Mitochondria and chloroplasts replicate by a process similar to mitosis.
Explanation:
Endosymbiotic theory states that mitochondria and chloroplast which are organelles of eukaryotic cells were once independently living micro-organisms but with due course of time eukaryotic cells engulfed them and they become an integral part of these eukaryotic cells.
The resemblance between mitochondrial genes with those of proteobacteria and chloroplast genes with photosynthetic bacteria strongly support endosymbiotic theory. Apart from this, the presence of their own DNA that too circular just like prokaryotic microbes and 70 S ribosomes also support this theory. Also just like prokaryotic cells, before cell division mitochondria and chloroplasts undergo replication by means of a process known as binary fission.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
The king snakes will be attacked and eaten by predators.
Explanation:
Mimicry can be described as a situation whereby an organism have the ability to imitate or copy one or more traits or character of another organism.
This can be described as a form of camouflage that organism exhibit to avoid been killed by predators, or to deceive other organism, by pretending to be one its species in order to kill it.
In the case, the harmless king snakes was trying to present itself as a harmful snake by mimicking the venomous coral snakes. Therefore, when it found itself where the coral snake are not wanted, it will be killed, because , it will be seen as a coral snake due to the mimicry process.
I would say A but i would get a second opinion
B. the ball is gaining kinetic energy and losing potential energy at position B
