1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KonstantinChe [14]
2 years ago
11

How kids today make slime and why each ingredient is used. What does each ingredient do and what happens if you change how much

is used?
Chemistry
1 answer:
Igoryamba2 years ago
4 0

Answer:

Find the steps and explanation below.

Explanation:

A. Kids make slime following these basic steps;

1. In a bowl, is 1/4 cup of water is added to 1 oz. of glue. Add coloring if you wish to.

2. 1/4 cup of Borax solution, also known as Sodium Tetraborate is added to the mixture and gradually stirred.

3. The mixture is kneaded with the hands to ensure a smooth consistency.

4. Water remnants are discarded and the slime is stored in a plastic bag and kept in the fridge.

B.

What each ingredient does

Polyvinyl acetate present in the glue acts as a liquid polymer.

Borax binds the liquid polymers together.

Water eases the mixing process

C.

If lesser ingredients are used, the slime will not have its characteristic slimy nature. If excess of the ingredients are used, the slime becomes very sticky.

You might be interested in
Which of the following is NOT an important physical property of matter?
IgorLugansk [536]
The best option is melting point 
4 0
3 years ago
How can you obtain hydrogen from a mixture of ethene, hydrogen and ammonia gases?​
irga5000 [103]

Answer:

We normally separate unreacted hydrogen from ammonia (product) in Haber process. The reaction mixture contains some ammonia, plus a lot of unreacted hydrogen and nitrogen. The mixture is cooled and compressed, causing the ammonia gas to condense into a liquid.

3 0
3 years ago
Bubbles in soda rise to the surface. Explain this in terms of density.
algol [13]

Answer:

Bubbles are comprised of gases, which have a lesser density than water. Since they are less dense, they get pushed up to the surface, and they rise, lighter than the liquid around them. This is just like helium in air; helium is lighter than air, so it rises, pushed to the top by the pressure around it.

PLS MARK THE BRAINLIST

7 0
3 years ago
A sea lab is to be designed to withstand submersion to 150 m, measured from the sea level to the top of the sea lab. Calculate t
Alchen [17]

Answer:

Explanation:

The hydrostatic pressure is defined as the pressure that is exerted by a fluid at equilibrium at a given point within the fluid, due to the force of gravity, the formula is:

P = ρgh + P₀

Where:

ρ is density (1020kg/m³)

g is gravity (9,8m/s²)

h is depth (150m)

P₀ is the atmspheric pressure (101325 Pa)

Replacing, P = 1'600'725 Pa

I hope it helps!

4 0
3 years ago
A 70.0-g piece of copper metal at 86.0 ∘c is placed in 50.0 g of water at 16.0 ∘c. The metal and water come to the same temperat
valentina_108 [34]
Copper is current voltage above 40 or 200 . copper useful for motor and some medicine
4 0
2 years ago
Other questions:
  • Explain the reaction between metallic hydroxides and a dilute acid?
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following statements about equilibrium of chemical reactions is correct? See Concept 8.2 (Page 147) View Available
    10·1 answer
  • A scientist made careful measurements of the pressure and temperature of many different gases. Based on these measurements, he c
    7·1 answer
  • Neither dry soil nor pure water conducts electricity but wet soil will conduct electricity. Explain why this happens?
    6·2 answers
  • What was the control in Pasteur's experiment?
    8·1 answer
  • Problem Page Question An analytical chemist weighs out of an unknown monoprotic acid into a volumetric flask and dilutes to the
    6·1 answer
  • How many molecules are in 18moles of CH.​
    12·1 answer
  • Convert a speed of 141 mi/h to units of feet per minute show work.
    10·1 answer
  • PLEASE HELP ME I DONT WANT TO FAIL
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!