1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WARRIOR [948]
2 years ago
9

From E=mc²=hv show that wavelength=h/mv​

Chemistry
1 answer:
barxatty [35]2 years ago
8 0

Explanation:

To show - from E=mc²=hv show that wavelength=h/mv​

Proof -

Given that,

E = mc²

E = hν

By equating both the equations, we get

mc² = hν

Because real particles do not travel at the speed of light, De Broglie submitted velocity ( v ) for the speed of light ( c ).

mv² = hν

Through the equation  λ , de Broglie substituted  v/λ  for  ν  and arrived at the final expression that relates wavelength and particle with speed.

mv² = hv/λ

⇒λ = hv/mv²

⇒λ = h/mv

Hence showed.

You might be interested in
21. an atom has 216 protons, how many electrons does it have?
yanalaym [24]

Answer:

21: 47 22: 14

Explanation:

4 0
2 years ago
B. Determine the percent composition of each element in NaCl. (1 point) Must show work to
andrey2020 [161]

Answer:

Sodium (Na): (.5 point)

22.99+35.453=58.433.   22.99/58.433=   39%

Chlorine (Cl): (.5 point)

22.99+35.453=58.433.   35.453/58.433= 61%

Explanation:

8 0
2 years ago
Which compound is used to make asphalt? a saturated hydrocarbon that has more than 35 carbons in its chain a saturated hydrocarb
svet-max [94.6K]

Answer:

answer is A. a saturated hydrocarbon that has more than 35 carbons in its chain

Explanation:

edge in 2020 :)

5 0
3 years ago
What is the total number of ions in one formula unit of (NH4)2CO3?
Len [333]

There are 3  ions in one formula unit of (NH4)2CO3.

Ions present in  Ammonium carbonate.(NH4)2CO3

(NH4)2CO3 is called Ammonium carbonate. The formula indicates that in one mole of ammonium carbonate, There are

  • Two moles of ammonium ions,NH₄⁺ with valency of +1.
  • 1 mole of Carbonate ions  CO₃²⁻  with valency of -2.

When 1 mole of ammonium carbonate is dissolved in water it gives

(NH₄)₂CO₃   ₊  H₂O---->2NH₄⁺    ₊  CO₃²⁻

Ions present are 2NH₄⁺   and CO₃²⁻

Learn more on (NH4)2CO3 here:brainly.com/question/2272720

4 0
2 years ago
Read 2 more answers
If a piece of metal has a density of 9.865 g and a volume of 14 ml, what is its mass?
vodka [1.7K]

Answer:

I think the answer is 138.11 gram

Explanation:

8 0
3 years ago
Other questions:
  • Thermal energy chemical change lab report
    15·1 answer
  • HELLPPPPPPPPPPPPP<br> :((((((((
    13·2 answers
  • Considering that catalysts are not consumed in a reaction, how do you think increasing the amount of catalyst would affect the r
    13·2 answers
  • When liquid detergent dissolves in water, which is the solvent and which is the solute
    6·1 answer
  • What is the most reactive metal on the periodic table?
    7·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Apple's "creative pros" and "evangelists," who help customers get the most out of their products and gain support for its produc
    8·1 answer
  • Please please help me please!!!?
    6·1 answer
  • A wave has 9.2 x 10-22 ) of energy. What is its wavelength?
    15·1 answer
  • Give reasons :
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!