1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
34kurt
3 years ago
10

During photosynthesis, carbon dioxide and (oxygen / sodium chloride / water / methane) are converted through a series of reactio

ns into two products: high-energy (proteins / hydrocarbons / sugars / sunlight) and (carbon dioxide / carbon monoxide / hydrogen/ oxygen) gas.
Biology
1 answer:
meriva3 years ago
5 0

Answer:

water, sugars, oxygen

Explanation:

You might be interested in
How do i determine a phenotype??
frutty [35]
A <span>phenotype is the actual physical characteristic of the gene. Its whatever you see.</span>
3 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
More than 100 locations were not listed in figure 1 because the amino acid was the same in all eight species. One possible expla
kenny6666 [7]
Some codons are sup pressed, so they do not appear to be producing any proteins. These amino acids may be part of such codons.
8 0
4 years ago
8. Why is an organism that reproduces asexually genetically identical to it's
amm1812

Answer:A

Explanation: A-sexual reproduction is basically the parent making a clone

8 0
3 years ago
Sheep are herbivorous. What can you Infer from this?
valentinak56 [21]

Answer:

Since sheep’s are herbivore, it can be inferenced they only eat plants. Due to the fact they only eat plants, means they are primary animals, and a have lots of predators. They have lots of predators due to the fact they are so low in the food chain, they are right above plants.

7 0
3 years ago
Other questions:
  • Which phylum of the animal kingdom includes all organisms which possess a spine (backbone)? chordata arthropoda annelida mollusc
    12·2 answers
  • 7. Which of the following classes of biological molecules include enzymes?
    12·1 answer
  • Last one:
    15·1 answer
  • ⦁ Fill in the description or the name of the organelle.
    15·2 answers
  • Changing genes by taking in different genetic material
    14·1 answer
  • The idea that pain signals must pass through a type of “doorway” in the spinal cord is referred to as the
    10·2 answers
  • What is an abiotic factor?
    8·1 answer
  • Which plant adaptation would you find in both a tundra and desert biome?
    10·1 answer
  • What do the chromosome pairs do in<br> meiosis?
    15·1 answer
  • The direction that an ocean current travels can be altered by the movement of the Earth's rotation on its axis. This is known as
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!