1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MaRussiya [10]
3 years ago
10

Which muscle elevates the eyebrows and wrinkles the forehead?

Biology
2 answers:
Murljashka [212]3 years ago
6 0

Answer:

b. Frontalis

Explanation: is correct

Sveta_85 [38]2 years ago
4 0

Answer: Frontail muscle

Explanation:

The frontalis muscle is responsible for elevating the eyebrows, while the corrugator supercilii, orbicularis oculi, and procerus play a role in its depression. The function of the forehead is often spared in middle cerebral artery strokes.

You might be interested in
Which of these is part of a feedback loop that results in a cooling effect on Earth?
irga5000 [103]

Answer:

B. As snow and ice melt, the underlying surfaces absorb heat from solar radiation

Explanation:

Which of these is part of a feedback loop that results in a cooling effect on Earth as snow and ice melt, the underlying surfaces absorb heat from solar

8 0
3 years ago
Read 2 more answers
What animals are most likely to survive in the wild?
DedPeter [7]

Explanation:

. Small Mammals. Rabbits, foxes, raccoons, squirrels, chipmunks, and badgers — it's hard to imagine a forest without small mammals.

. Large Mammals. Deer, bear, bobcats, moose, and more – the forest is filled with large animals.

. Insects. ...

. Reptiles & Amphibians. ...

. Birds.

<u>These animals live in the wild. </u>

Hope I helped..

5 0
3 years ago
Read 2 more answers
What is a consumer????????????????
gtnhenbr [62]

Answer:

a person who purchases goods and services for personal use.

Explanation:

3 0
3 years ago
If two organisms share the same Order, what other taxa do they share?
allochka39001 [22]
They have kingdom, class, and phylum, I’m kind of confused about the answer because of that.
7 0
3 years ago
What is true of carbon atoms?
masha68 [24]
Carbon atoms have more mass than other atoms. They have 6 protons and 6 neutrons plus 6 electrons!
3 0
4 years ago
Other questions:
  • Blood is a mixture both of a ------- and a -------- (fill in the blank)
    5·1 answer
  • What might occur if the sphincter between the esophagus and stomach doesn't close correctly, and some of the stomach contents en
    5·1 answer
  • Investigator a conducts research on emphysema using biospecimens from human subjects. the consent form indicates that the resear
    12·1 answer
  • Which is the central element for all living things?
    7·1 answer
  • The ras proto-oncogene can become an oncogene by a single point mutation that alters its protein product to have _______ activit
    10·1 answer
  • A rapid temperature increase about 55 mya created tropical conditions around the world, resulting in the:
    7·1 answer
  • Who was similar to the cheddar man?
    11·1 answer
  • What was Harriet Tubman's Quote?
    6·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Austin is in a study related to Mary Ainsworth's theory of mother-infant attachment. He is securely attached. Therefore, he show
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!