1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
13

Question 3 (5 points)

Biology
2 answers:
djyliett [7]3 years ago
8 0
Argon is the least abundant gas. The atmosphere only contains 0.9% argon.
lorasvet [3.4K]3 years ago
3 0
B Carbón dioxide
Not sure
You might be interested in
The Heimlich maneuver is a series of pushing motions on the area just under the diaphragm that helps a person whose airway is bl
Ratling [72]

Answer:

Pushing the diaphragm causes air to flow out of the lungs, which pushes the blockage out.

Explanation:

3 0
3 years ago
Read 2 more answers
According to the ______________ theory, a population may go long periods of genetic stability, interspersed with short periods o
ikadub [295]
<span>This theory is called punctuated equilibrium. In this theory it is explained that there are very long periods of no change at all to a species, yet there are also bursts of evolutionary change interspersed within the time period. The period of remaining the same throughout time (most of the time) is called stasis, and is present within this theory of punctuated equilibrium.</span>
3 0
3 years ago
Read 2 more answers
What is the function of the Pleurae?
Doss [256]

Answer:

The function of the pleura is to allow optimal expansion and contraction of the lungs during breathing. The pleural fluid acts as a lubricant, allowing the parietal and visceral pleura to glide over each other friction free. This fluid is produced by the pleural layers themselves.

8 0
2 years ago
Nico wants to buy a new digital camera for his semester studying abroad but he knows very little about cameras, having never own
scZoUnD [109]

Answer:

an external search

Explanation:

According to my research on the consumer buying process, I can say that based on the information provided within the question Nico is engaging in an external search. In Marketing, this term refers to when an individual has no knowledge of a product and therefore seeks out information from personal contacts or various public sources in order to make an informed decision. Which in this case is what Nico is doing by asking in different places about cameras.

I hope this answered your question. If you have any more questions feel free to ask away at Brainly.

4 0
3 years ago
A client has been prescribed timolol eye drops. what are three (3) possible adverse effects of this medication and nursing inter
vlada-n [284]
The three (3) possible adverse effects of this medication and nursing interventions/client are the following;
First is Prevention of nocturnal enuresisSecond is Maintenance of appropriate body water content in diabetes insipidus And the last is Control of bleeding in certain types of hemophilia or von Willebrand's disease(Davis's Drug Guide for Nurses 14th Edition)
7 0
3 years ago
Read 2 more answers
Other questions:
  • Chemical reactions in cells are faster than the same reactions outside cells.
    10·1 answer
  • What is the origin of each strand of the new double helices created after DNA replication?
    7·1 answer
  • What is the role of pollen tube in spermopsida
    12·2 answers
  • Uaggas once lived in South Africa. They are now extinct. People hunted them for their hides and meat. Quaggas fed on grass, whic
    8·1 answer
  • Which hemostatic agent is used primarily to control capillary bleeding from within extraction sockets?
    11·1 answer
  • During diastole, atria receives :-
    10·1 answer
  • This is the study of the natural processes that occur in the environment and how humans can affect them?
    14·2 answers
  • Hii! i’ll give brainliest pls help
    7·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Which part of a plant are used to attract birds and insects called
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!