When plants undergo transpiration, they are returning water back to the atmosphere.
Answer:
According to the number of sequence on DNA there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.
Explanation:
DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-
GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-
GAG UUU AUC CCC AAC UUG GCA UAA GGU AGG-
Glutamine, Phenylalanine, Isoleusine, Proline, Asparagine , Leucine, Alanine, stop codon. As ribosome reach on stop codon protein synthesis stopped and process aborted.
Mutations can occur at higher rates in viruses.
Explanation:
The mutation rate of an organism refers to the rate or average number of errors which are formed in the genome of the organism’s progeny per base per replication cycle.
Accordingly the Mutations of viruses are the highest per base pair per generation mutation. Viruses can mutate more than a million times than the host’s body due to their virulence factor, evolution ability, and presence of a variety of traits.
Of the DNA and RNA viruses, the RNA viruses like the Retroviruses having a much higher rate, for example, the HIV virus which is a Retrovirus has high mutation rate.
Answers
1. 8 electrons
2. 10 electrons
3. 10 electrons
4. 8 from the oxygen atom and 1 from each of the 2 hydrogen atoms
5. 4 hydrogen bonds
Explanation
The atomic number of oxygen is 8 thus it has a total of 8 electrons. When writing the electron configuration for the oxygen, the first n shell requires two electrons to complete the 1st orbital. The fact that 1s holds a maximum of 2 electrons the next 2 electrons of oxygen goes to 2s orbital. The 2s orbital takes a maximum of two electrons and the remaining 4 electrons occupy the 2p orbital. The configuration formed will be 1s² 2s² 2p4 .The maximum number of electrons in the second shell is 2n²=2×2² =8 from the formula 2n² (the maximum number of electrons in a shell). The total number of electrons in the second shell is 2(in s orbital) +4 (in p orbital) =6.The number of unpaired electrons is 8-6=2
A water molecule has four hydrogen bonds, because it is made up of two hydrogen atoms and an oxygen atom. A water molecule has 10 protons and 10 electrons thus it is neutral. In the water molecule there is formation of covalent bonds where oxygen atom and hydrogen atoms share electrons though the sharing is not equal. In the covalent bond, the oxygen atoms attract electrons more than the hydrogen atoms.
Answer:
Option A , Hours of daylight does not affect the weather
Explanation:
The seven prime factors that affect the weather are
Temperature
Pressure
Moisture content
Speed and direction of air
Latitude
Ocean currents
Elevation and bodies of water.
Hence, option A , Hours of daylight does not affect the weather
