1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
6

can someone help me pls, it's abt things made with one type of matter all the way through. will give brain if it's a good answer

Chemistry
1 answer:
natka813 [3]3 years ago
3 0

Answer: well there is a lot of examples that can be used but i feel like a good answer will be a flower peddle once broken its still a peddle but its either larger or smaller than what it originated. another example can be a tree. you can have many trees that are huge in size or you can have small ones. once snapped in half it will still be a tree but the size of the tree will not remane the same but it will still be a tree through and through

Explanation:

You might be interested in
3 waves are shown with a line through their center. The bottom of the first wave is labeled C. A bracket labeled D connects the
Likurg_2 [28]

Answer:Label the parts of this wave.

A:  

✔ crest

B:  

✔ amplitude

C:  

✔ trough

D:  

✔ wavelength

Explanation:

8 0
3 years ago
Read 2 more answers
What effect did the Punic Wars have on Rome's military development? (4 points)
Doss [256]

Answer:

The correct answer is: “The Roman army grew in size and became dominant in the Mediterranean region”.

Explanation:

The Punic wars were a series of three wars that were fought between Rome and Carthage. At the end of the third war, Rome established itself as an empire, it conquered the Carthage’s empire, destroyed it completely and became the most powerful state of the Western Mediterranean.

6 0
3 years ago
How many significant figures are there in the following numbers: 10.78, 6.78, 0.78? If these were pH values, to how many signifi
Ksivusya [100]

Answer:

10.78 → 4 significant figures, pH = 10.78 → [H⁺] = 1.66ₓ10⁻¹¹ M

6.78 → 3 significant figures, pH = 6.78 → [H⁺] = 1.66ₓ10⁻⁷ M

0.78 → 2 significant figures, pH = 0.78 → [H⁺] = 0.166 M

pH always can be expressed by at least 4 significant figures. The [H⁺], can be expressed by, at least 3 significant figures

Explanation:

Significant figures are the numbers of a measurement that have certainty plus a doubtful number (it is associated with the uncertainty in the measurement). For example, if we measure a paper with a ruler and the ruler measures up to centimeters we can say that the paper is 7.5 cm long, with which we know that the paper is 7 cm + 0.5 cm which we associate with uncertainty. In this case we talk about two significant figures. If the sheet measured 7.57 cm we would already be talking about a more precise measurement and in this case with 3 significant figures.

10.78 → 4 significant figures

6.78 → 3 significant figures

0.78 → 2 significant figures

To determine [H⁺], we apply 10^-pH

10⁻¹⁰°⁷⁸ = 1.66ₓ10⁻¹¹ M

10⁻⁶°⁷⁸ = 1.66ₓ10⁻⁷ M

10⁻⁰°⁷⁸ = 0.166 M

3 0
3 years ago
What does initial buret and final buret reading mean
ikadub [295]
Initial buret reading means the volume of acid taken in the buret and final reading means the remaining volume of acid after experiment
 
4 0
3 years ago
While diluting some concentrated hcl, a student accidentally got some of the acid on his/her bare hands. what is the appropriate
rjkz [21]
<span>Chemicals like HCL should be immediately washed off. HCL is caustic to the skin and will cause the skin to dissolve. While dilute HCL solutions found in secondary school classrooms are unlikely to cause immediate burns, hydrochloric acid is extremely acidic and will leave permanent scars before very long</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following apply to diffusion. Select all that apply. Solids can diffuse in liquids. Liquids can diffuse in liquids.
    13·2 answers
  • After 11.5 days, 12.5% of a sample of radon-222 that originally weighed 42g remains. What is the half-life of this isotope?
    8·1 answer
  • Which force causes the rock materials to move from A to B A.Electricity
    11·1 answer
  • By pushing backwards a roller skater moves forward. This is an example of Newton's
    5·1 answer
  • What is the relationship between the frequency of electromagnetic waves and their wavelengths? A. As frequency increases, wavele
    8·2 answers
  • Why is charcoal black?
    6·1 answer
  • Why do chemical equations have to be balanced
    5·1 answer
  • What was the eutectic temperature (temperature from the two lines of best fit cross) for the mixture
    11·1 answer
  • What is the energy of a photon emitted with a wavelength of 448 nm?
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!