1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
noname [10]
2 years ago
12

Identifying living things

Biology
1 answer:
Andrew [12]2 years ago
8 0

Answer:

These are the seven characteristics of living organisms.

1 Nutrition. Living things take in materials from their surroundings that they use for growth or to provide energy.

2 Respiration.

3 Movement.

4 Excretion.

5 Growth.

6 Reproduction.

7 Sensitivity.

hope it helps you out

Explanation:

okie

You might be interested in
What is photosynthesis?
dem82 [27]
Photosynthesis is the process when the plant takes in carbon monoxide and turn it into oxygen and also makes sugar I think but it uses sunlight too.
7 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
How do plants on earth affect the amount of carbon in earths atmosphere
Hoochie [10]
<h3>ANSWER:</h3>

               In case of plants there is a process called PHOTOSYNTHESIS occurs. A photosynthesis is a process in which the carbon and water involves and as a result oxygen plus glucose forms. And because of that plants cause the atmospheric Carbon dioxide decreases as they use the carbon dioxide in the atmosphere.

8 0
3 years ago
Identify a signal the brain sends out after the nervous system sends the signal that pH has dropped.
spin [16.1K]

In response to a notification of a <u>decrease</u> in blood pH by the nervous system, the brain sends signals to the external intercostal muscles and the diaphragm.

<h3>What is blood pH?</h3>

Blood pH can be defined as a measure of the molar concentration of hydrogen ions that are present in the blood of a living organism, with respect to its acidity, neutrality or alkanlity (basicity).

In response to a notification of a <u>decrease</u> in blood pH by the nervous system, the brain would send signals (impulses) to the external intercostal muscles and the diaphragm through its respiratory center, so as to help the living organism increase its breathing rate and the volume of its lungs during inhalation.

Read more on blood pH here: brainly.com/question/11209525

6 0
2 years ago
This polysaccharide is the most abundant organic compound on
Mkey [24]

Answer:b. cellulose; cell walls of plants

Explanation: polysaccharides are polymers of monossacharides.they are the most abundant organic substance.it is found in the cell walls of plants . cellulose is a linear polymer of glucose residues.cellulose is an important component in the diet of herbivores and omnivores.they do not produce the cellulase enzyme for digesting cellulose.as a result,they depend on symbiotic relationship with bacteria and protozoa found in their stomach to produce cellulase.

3 0
3 years ago
Other questions:
  • What is the role of a producer?
    11·2 answers
  • What are the structures that contain the DNA of each cell? A. Ribosomes B. Golgi bodies C. Chromosomes D. Cell membrane
    12·2 answers
  • Amino acids are the building blocks of proteins. Which of these best describes an amino acid?
    5·2 answers
  • Where glycolysis occurs in the cell
    14·1 answer
  • The human number of chromosomes is 46, so this means:
    7·1 answer
  • Based on the textbook's description of the inheritance of hair texture, can two parents heterozygous for wavy hair still produce
    15·1 answer
  • The graph represents changes to two jackrabbit populations in two different areas over 15 years.
    12·1 answer
  • Dua kaedah memelihara dan memulihara spesies endemik<br>​
    13·2 answers
  • Which of the following can be assumed about a protist that has both flagella and chlorophyll?
    14·1 answer
  • What is the function of the organelles that are labeled F?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!